|
Advertisement |
|
|
||
 |
|
|||||
|
|||||
|
 |
||||||
|
||||||
|
||||||
|
© 2001 American Society for Clinical Oncology K-ras and p16 Aberrations Confer Poor Prognosis in Human Colorectal CancerFrom the Johns Hopkins Oncology Center, Baltimore, MD; Laboratori d’Investigacio Gastrointestinal, and S. Oncología Médica, Hospital de la Santa Creu i Sant Pau; Institut Català d’Oncologia and Institut de Recerca Oncològica, Hospital Duran i Reynals, Barcelona, Spain. Address reprint requests to Gabriel Capellà, MD, PhD, Institut Català d’Oncologia. Av. Gran Via s/n Km 2,7 08907 L’Hospitalet de Llobregat, Barcelona, Spain; email gcapella{at}ico.scs.es
PURPOSE: Mutations in the K-ras gene are frequent in human cancer. ras activation in primary cells results in a cellular senescence phenotype that is precluded by inactivation of p16. At the clinical level, this may imply a differential behavior for tumors with alternative or cooperative activation of K-ras function and impairment of p16 pathways. PATIENTS AND METHODS: We have determined the presence of mutations in the K-ras gene and the methylation status of p16 promoter in a series of 119 prospectively collected colorectal carcinomas. p53 mutations and p14 alternative reading frame methylation status were also assessed. Associations with survival were investigated. RESULTS: K-ras mutations were present in 44 (38%) of 115 cases, and p16 methylation was present in 42 (37%) of 113 cases. p53 mutations were detected in 50% (56 of 115) and p14 methylation in 29% (32 of 112) of cases. K-ras and p16 alterations were independent genetic events. Presence of K-ras or p16 genetic alterations (analyzed independently) was associated with shorter survival, although differences were not statistically significant. Cox analysis of the two variables combined showed a diminished survival as the results of an interaction between p16 and K-ras. Alternative alteration of K-ras and p16 genes was an independent prognostic factor in human colorectal cancer in univariate and multivariate analysis. Differences were maintained when cases undergoing radical surgery and without distant metastases were considered. CONCLUSION: These results suggest that the combined K-ras and p16 analyses may be of prognostic use in human colorectal cancer.
COLORECTAL CANCER IS one of the best-studied systems of multistage human carcinogenesis.1 ras genes encode for membrane-attached small guanine triphosphate–bound proteins that play a key role in signal transduction of extracellular mitogenic signals (such as growth factors) to the nucleus. ras mutations are frequent in human tumors. K-ras mutations (mainly at codons 12 and 13) that constitutively activate their function are present in up to 40% of colorectal adenomas and carcinomas.2-4 Disruption of the p53 and retinoblastoma (Rb) tumor suppressor pathways is a fundamental trend of most human cancer cells.5 Up to 50% of colorectal tumors harbor p53 mutations and other alterations that may impair this pathway (ie, p14 alternative reading frame [p14ARF] inactivation) occur at a significant frequency.6 Among alterations leading to loss of Rb function, p16 seems to play a major role in colorectal cancer. The p16INK4a gene is located on chromosome 9p21 and encodes a G1 cyclin-dependent kinase (CDK) inhibitor7 that binds preferentially to CDK4 and CDK6, preventing their association with D-type cyclins and the ensuing phosphorylation of substrates such as the pRb. p16 absence may cause abnormal cell cycling and uncontrolled cell growth. Inactivation of p16 in human colorectal cancer occurs in a significant proportion (20% to 50%) of human colorectal tumors, preferentially through de novo methylation of its 5'-promoter associated CpG island.6,8-10 Oncogenic ras initially forces uncontrolled proliferation followed by cell arrest in primary rodent fibroblasts mediated by p1611 and the p53-p14ARF axis.12,13 In colorectal cancer, the relationship between K-ras and/or p53 gene mutations and survival has been controversial. Recently, we showed that p53 and the combination of K-ras and p53 gene mutations correlate with tumor aggressiveness.4 Nevertheless, this correlation was not significant when only cases undergoing a radical resection (R0) were considered. The aim of this study was to assess the clinical usefulness of K-ras activation and p16 inactivation in human colorectal carcinomas using a prospective design with long-term follow-up. p53 and p14ARF alterations were also assessed. We show that K-ras and p16 alterations are independent genetic events and that the combination of K-ras and p16 alterations associates with tumor aggressiveness in colorectal cancer patients undergoing radical resection. The prognostic utility of this assessment has been confirmed using multivariate analysis techniques.
Study Design Between July 1991 and June 1994, 158 patients preoperatively diagnosed of colorectal cancer at the Hospital de la Santa Creu i Sant Pau, Barcelona, Spain, were prospectively included in a study designed to evaluate the prognostic value of genetic alterations. Inclusion criteria included the following: (1) electively resected primary adenocarcinomas; (2) processing of fresh paired normal mucosa-tumor samples within 2 hours after tumor removal; (3) no postoperative death; and (4) available DNA from normal and tumor tissue. Inclusion in the study did not influence the adjuvant treatment given. The study protocol was approved by the ethics committee. No chemo- or radiotherapy was given before surgery in these patients. Follow-up end point was January 1999. One hundred nineteen of the 158 patients were finally included in this study because of limitations in the amount of DNA available for genetic analysis. The most important characteristics of the cases considered were sex (64 male and 55 female) and age (mean, 66 ± 12 years; range, 33 to 89 years). Thirty-five tumors were located in the right colon and 84 in the left colon including the rectum. The distribution of the carcinomas according to Astler-Coller modification of Dukes’ cancer staging system was as follows: 16 patients had A+B1, 47 had B2+B3, 31 had C, and 25 had D. No differences were observed between excluded and included cases. For survival analysis, only tumors from patients undergoing a radical surgical resection (R0), defined by the absence of macroscopic or microscopic remnant disease and not Dukes’ D, were considered (n = 90). Mean follow-up was 68 ± 14 months (range, 16 to 89 months). At last follow-up (January 1999), 57 patients were alive without disease, nine were dead without disease, three were alive with disease, and 50 were dead of the disease.
Detection of K-ras and p53 Mutations and p16 Methylation
p53 mutations were analyzed in exons 4 to 9 by SSCP and direct cycle sequencing, as described.4 Briefly, a first PCR was performed using primers 12979U 5' GCTGCCGTGTTCCAGTTGCT 3' and 14875D 5' AGGCATCACTGCCCCCTGAT 3'. The resulting 1,897-bp fragment was then used as a template to separately amplify a fragment of 410 bp, including exons 5 and 6 (primers 13054U 5' TACTCCCCTGCCCTCAACAAG 3' and 13463D 5' CTCCTCCCAGAGACCCCAGT 3'), and a fragment of 622 bp, including exons 7 and 8 (primers 13966U 5' CTGGCCTCATCTTGGGCCTG 3' and 14587D 5' CTCGCTTAGTGCTCCCTGGG 3'). These two fragments were then digested with restriction enzyme HpaII, and the resulting fragments were run on a 6% polyacrylamide gel without glycerol (0.2 hours at 30 W and 5 to 6 hours at 6 W) and with a 10% glycerol (0.2 hours at 30 W and 13 to 14 hours at 6 W) to detect mobility shifts. Mutations were confirmed by direct cycle sequencing of the PCR products using the AmpliCycle Sequencing Kit (Perkin Elmer, Branchburg, NJ). Exons 4 and 9 were only analyzed on those samples with normal SSCP patterns in exons 5 to 8. Exon 4 was amplified directly from DNA using primers 12019U 5' TCCCCCTTGCCGTCCCAAG 3' and 12349D 5' TACGGCCAGGCATTGAAGTC 3'. The resulting 331-bp fragment was run without previous digestion on a 6% polyacrylamide/10% glycerol gel for 0.2 hours at 30 W and 19 hours at 6 W. To analyze exon 9, a fragment of 788 bp including exons 7 to 9 was amplified with primers 13966U 5' CTGGCCTCATCTTGGGCCTG 3' and 14753D 5' CTGAAGGGTGAAATATTCTCC 3' and digested with HhaI to produce two fragments of 548 bp and 240 bp, the last one containing exon 9. DNA methylation patterns in the CpG islands of p16 gene were determined by methylation-specific PCR (MSP).15 MSP distinguishes unmethylated from methylated alleles in a given gene based on sequence changes produced after bisulfite treatment of DNA, which converts unmethylated, but not methylated, cytosines to uracil, and subsequent PCR using primers designed for either methylated or unmethylated DNA. DNA methylation patterns in the 5'-CpG island of p16 and p14 were determined by MSP, as previously described.15,6 DNA treated in vitro with SssI methyltransferase was used as a positive control for methylated alleles. DNA from normal lymphocytes was used as negative control for methylated genes. Ten mL of each PCR reaction was directly loaded onto nondenaturing 6% polyacrylamide gels, stained with ethidium bromide, and visualized under ultraviolet illumination. Representative data for p16 methylation analyses are depicted in Fig 2.
Statistical Analysis Contingency tables were analyzed by Fisher’s exact test or  2 test. Disease-free and overall survival distributions were estimated by the Kaplan-Meier method and were compared using the log-rank test. Also, univariate and multivariate analyses were performed using the Cox proportional hazards model. Cox models were used to assess the combined effect of K-ras and p16 aberrations. All reported P values are derived from two-sided statistical tests.
Genetic Analysis K-ras mutation analysis was possible in 115 cases. Forty-four tumors (38%) contained a mutation at codon 12 or 13 of the K-ras gene. The spectrum of mutations was as follows: GAT12 (n = 20), GAC13 (n = 12), TGT12 (n = 4), AGT12 (n = 2), GTT12 (n = 2), GCT12 (n = 1), and three tumors contained double mutations in codons 12 and 13, GAT12 and GAC13. p16 methylation status was determined in 113 of the 119 cases attempted. p16 was methylated in 42 tumors (37%). Fifty-six tumors out of 115 cases with complete p53 analysis were positive for p53 mutations. Finally, p14 methylation status was determined in 112 of the 119 cases, and in 32 cases (28.6%), hypermethylation was detected. In 109 cases, information for both ras and p16 molecular markers was available. Both alterations concurred in 15 cases (9.5%) and seemed to occur independently. Forty-four tumors did not show aberrations of any gene, and in the remaining 50 cases, each gene was altered in half of the tumors (P = not significant). The type of mutation at K-ras was not associated with p16 methylation. Finally, p53 mutations were independent of p16 methylation status (n = 109; 21 were +/+, 20 were -/+, 34 were +/-, 34 were -/-; P = not significant).
Molecular Correlates of Clinicopathologic Variables
Survival Analysis
Then, Cox models were used to gain insight into the interaction between K-ras and p16 aberrations. On the one hand, p16 methylation seemed to increase the hazard in those patients harboring K-ras(-) tumors (hazards ratio, 3.3; 95% confidence interval, 1.0 to 10.5; P = .03). On the other hand, a trend was observed toward a raised hazard in those patients with unmethylated p16 tumors harboring a K-ras mutation (hazard ratio, 2.8; 95% confidence interval, 0.8 to 8.9; P = .07). Therefore, the combination of both interactions resulted in the observed better prognosis of K-ras(-)/p16(-) tumors. Finally, all observations did not differ when patients with disseminated cancer were included in the analyses (data not shown).
In the present study, we have shown that K-ras and/or p16 alterations are independent genetic alterations and that the presence of either alteration associates with poorer outcome in human colorectal cancer. These observations suggest that the combined molecular analysis of these two genes may have prognostic applications in colorectal neoplasm. ras mutations, mainly at codons 12 and 13 of the K-ras gene, occur early in adenoma growth and are present in approximately 40% to 50% of colorectal carcinomas. The impact of ras mutations in colorectal tumorigenesis is high and several studies have suggested that K-ras mutations might accumulate during tumor progression and associate with poorer survival.16-19 However, its use as an independent prognostic factor has not been demonstrated.4,20 p16 is a tumor-suppressor gene recognized now as the second most common molecular defect in human cancer. According to our results and in agreement with previous studies,6,8-10,21 p16 inactivation, through promoter hypermethylation, is as frequent as K-ras mutations in colorectal cancer. Therefore, it also is likely to play a major role in colorectal tumor progression. K-ras mutation and p16 methylation seem to be independent genetic events. This is in contrast with observations by Guan et al,21 who reported a tight correlation between K-ras mutations and p16 inactivation in a shorter series of human colorectal neoplasm. Serrano et al11 have postulated that a common ras-p16 pathway exists. They have hypothesized that this link might exist to protect normal cells against oncogenic stimuli. Either p16 or p53 would mediate cell cycle arrest and senescence as a safety mechanism against ras activation in normal fibroblasts. The observed independence of both alterations in colorectal tumor cells could be interpreted as if K-ras and p16 alterations converge in a common pathway, and once the oncogenic potential of one component is unveiled, a second alteration is only occasionally selected. In our study, we have observed a strong association between the presence of K-ras and/or p16 aberrations and poor outcome. When combining K-ras and p16 analyses, a reciprocal interaction has been observed; p16 methylation does have an apparent effect on survival if K-ras is not inactivated and vice versa. These observations suggest that aberrations of either gene have a similar impact on tumor aggressiveness. The lack of association with poor survival of each alteration independently analyzed and the fact that the concurrence of alterations in both genes does not associate with a more malignant phenotype may be also interpreted as an indirect evidence supporting the existence of a K-ras/p16 axis in human colorectal cancer cells. Our observations also suggest that aberrations of this putative axis are important in human colorectal tumorigenesis conditioning tumor behavior. However, it must be taken into account that its alteration, through K-ras mutation or p16 methylation, is not apparently necessary for transformation because up to 37% of colorectal tumors do not harbor detectable alterations in either gene. The relevance of K-ras/p16 alterations is underlined by the fact that such strong association of both alterations with survival has not been found when K-ras and p53 mutations have been studied.4 In rodent and human fibroblasts, ras-induced uncontrolled proliferation also provokes a p53-mediated cell cycle arrest.11,13 Recently, we showed, in a larger series of tumors, that p53 and the combination of K-ras and p53 gene mutations correlate with tumor aggressiveness4 when disseminated tumors were included. In contrast with p16, this correlation was no longer apparent when only cases undergoing a radical resection (R0) were considered. It might happen that such association was not apparent because of the limited information provided by p53 mutation analysis regarding p53 pathway inactivation. Among other p53 inactivating mechanisms, p14ARF loss of function has been postulated to play a significant role. Recent work strongly suggests that p14ARF interact in vivo with the MDM2 protein, neutralizing MDM2-mediated degradation of p53.22,23 p14ARF hypermethylation has been observed in approximately a quarter of the neoplasm studied. Although more frequent in tumors with wild-type p53, it is also observed in those with p53 mutations. Finally, the combined alterations of p53 and p14ARF with K-ras alterations were not able to identify any subgroup of patients with distinct clinical outcome. The extent of tumor bowel wall infiltration and lymph node metastases, both included in Dukes’ stage and tumor-node-metastasis classification systems, are the most important prognostic factors in colorectal cancer. Nevertheless, these parameters are accurate for predicting recurrence only in 50% to 75% of the patients with nonmetastatic invasive colorectal carcinoma. The presence of K-ras and/or p16 inactivation seems to be an independent prognostic factor capable of identifying a subgroup of patients with poor outcome independent of Dukes’ stage. Therefore, the combined K-ras and p16 analysis may be useful for selecting those patients who would be good candidates for more aggressive adjuvant therapies. In summary, we have shown that K-ras and p16 alterations are independent genetic events in colorectal carcinomas. The presence of K-ras or p16 genetic alterations (analyzed independently) was associated with shorter survival, although differences were not statistically significant. The combined analysis of the two variables showed that alternate or simultaneous alteration of the K-ras and p16 genes was an independent prognostic factor in human colorectal cancer in univariate and multivariate analysis, suggesting that their simultaneous analysis may be of prognostic use in the clinical setting.
Supported in part by grants from Comisión Interministerial de Ciencia y Tecnología (CICYT), Fondo de Investigación Sanitaria (FIS), and Fundació La Marató de TV3. M.E. is recipient of Spanish Ministerio de Educacion y Cultura Award; R.A.R. is a fellow of Comissió Interdepartamental de Recerca i Innovació Tecnològica (CIRIT).
The first two authors contributed equally to this work. J.G.H. is a Valvano Foundation Scholar. J.G.H. receives research funding and is entitled to sales royalties from ONCOR, Intengen, Purchase, NY, which is developing products related to research described in this paper. The terms of this arrangement have been reviewed and approved by The Johns Hopkins University in accordance with its conflict of interest policies.
1. Fearon ER, Vogelstein B: A genetic model for colorectal tumorigenesis. Cell 61: 759-767, 1990[Medline] 2. Capella G, Cronauer-Mitra S, Peinado MA, et al: Frequency and spectrum of mutations at codons 12 and 13 of the c-K-ras gene in human tumors. Environ Health Perspect 93: 125-131, 1991[Medline]
3.
Shibata D, Schaeffer J, Li ZH, et al: Genetic heterogeneity of the c-K-ras locus in colorectal adenomas but not in adenocarcinomas. J Natl Cancer Inst 85: 1058-1063, 1993
4.
Tortola S, Marcuello E, Gonzalez I, et al: p53 and K-ras gene mutations correlate with tumor aggressiveness but are not of routine prognostic value in colorectal cancer. J Clin Oncol 17: 1375-1381, 1999
5.
Sherr CJ: Cancer cell cycles. Science 276: 1672-1677, 1996
6.
Esteller M, Tortola S, Toyota M, et al: Hypermethylation-associated inactivation of p14ARF is independent of p16INK4A methylation and p53 mutational status. Cancer Res 60: 129-133, 2000 7. Serrano M, Hannon GJ, Beach D: A new regulatory motif in cell-cycle control causing specific inhibition of cyclinD/CDK4. Nature 366: 704-707, 1993[Medline]
8.
Herman JG, Merlo A, Mao L, et al: Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res 55: 4525-4530, 1995
9.
González-Zulueta M, Bender CM, Yang AS, et al: Methylation of the 5` CpG methylation island of the p16/CDKN2 tumor suppressor gene in normal and transformed human tissues correlates with gene silencing. Cancer Res 55: 4531-4535, 1995
10.
Wiencke JK, Zheng S, Lafuente A, et al: Aberrant methylation of p16INK4a in anatomic and gender-specific subtypes of sporadic colorectal cancer. Cancer Epidemiol Biomarkers Prev 8: 501-506, 1999 11. Serrano M, Lin AW, McCurrach ME, et al: Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 88: 593-602, 1997[Medline]
12.
Lin AW, Barradas M, Stone JC, et al: Premature senescence involving p53 and p16 is activated in response to constitutive MEK/MAPK mitogenic signaling. Genes Dev 12: 3008-3019, 1998 13. Palmero I, Pantoja C, Serrano M: p19ARF links the tumor suppressor p53 to Ras. Nature 395: 125-126, 1998[Medline]
14.
Mora J, Puig P, Boadas J, et al: K-ras gene mutations in the diagnosis of fine-needle aspirates of pancreatic masses: A prospective study using two techniques of different sensitivity. Clin Chem 44: 2243-2248, 1998
15.
Herman JG, Graff JR, Myohanen S, et al: Methylation specific PCR: A novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA 93: 9821-9826, 1996 16. Bell SM, Scott N, Cross D, et al: Prognostic value of p53 overexpression and c-K-ras gene mutations in colorectal cancer. Gastroenterology 104: 57-64, 1993[Medline] 17. Tanaka M, Omura K, Watanabe Y, et al: Prognostic factors of colorectal cancer: K-ras mutation, overexpression of p53 protein and cell proliferative activity. J Surg Oncol 57: 57-64, 1994[Medline] 18. Span M, Moerkerk P, De Goeij AF, et al: A detailed analysis of K-ras point mutations in relation to tumor progression and survival in colorectal cancer patients. Int J Cancer 69: 241-245, 1996 (published erratum in Int J Cancer 69:355, 1996)[Medline]
19.
Ahnen DJ, Feigl P, Quan G, et al: Ki-ras mutation and p53 overexpression predict the clinical behavior of colorectal cancer: A Southwest Oncology Group study. Cancer Res 58: 1149-1158, 1998 20. The American Society of Clinical Oncology: Clinical practice guidelines for the use of tumor markers in breast and colorectal cancer. J Clin Oncol 14:2843-2877, 1996 21. Guan RJ, Fu Y, Holt PR, et al: Association of K-ras mutations with p16 methylation in human colon cancer. Gastroenterology 116: 1063-1071, 1999[Medline] 22. Pomerantz J, Schreiber-Agus N, Liegeois NJ, et al: The Ink4a tumor suppressor gene product, p19ARF, interacts with MDM2 and neutralizes MDM2’s inhibition of p53. Cell 92: 713-723, 1998[Medline] 23. Zhang Y, Xiong Y, Yarbrough WG: ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways. Cell 92: 725-734, 1998[Medline] Submitted February 9, 2000; accepted August 14, 2000. This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
|||||||||||
|
|||||||||||
|
|
Copyright © 2001 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
|
TOP
ABSTRACT
INTRODUCTION
