This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Services Email this article to a colleague Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Save to my personal folders Download to citation manager Rights & Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Forslund, A. Articles by Lundholm, K. Search for Related Content PubMed PubMed Citation Articles by Forslund, A. Articles by Lundholm, K.

Mutations and Allelic Loss of p53 in Primary Tumor DNA From Potentially Cured Patients With Colorectal Carcinoma

From the Surgical Metabolic Research Laboratory at the Lundberg Laboratory for Cancer Research, Department of Surgery, Sahlgrenska University Hospital, Göteborg, Sweden.

Address reprint requests to Kent Lundholm, MD, PhD, Department of Surgery, Sahlgrenska University Hospital, SE 413 45 Göteborg, Sweden; email: kent.lundholm{at}surgery.gu.se

	ABSTRACT

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION REFERENCES

 
PURPOSE: To compare p53 alterations in survivors and nonsurvivors after surgery for colorectal cancer.

PATIENTS AND METHODS: Twenty-nine potentially cured patients with colorectal carcinoma, without recurrent disease for more than 6 years after their primary surgery, were selected to match a group of 41 colorectal cancer patients with early metastatic spread to the liver. All patients were screened for mutations in the p53 gene, exons 5 to 9, by denaturing gradient gel electrophoresis and subsequent sequencing.

RESULTS: The frequency of p53 mutations was significantly different in cured patients (60%) compared with patients with early relapse (41%, P < .05). A significant difference was found in the distribution of mutations, indicating that potentially cured patients had a different proportion of mutations in conserved regions of p53 (P = .02). This difference was explained by a significantly different frequency of mutations in exon 8 (40% v 15%, P = .03), which is part of the conserved region V. All mutations in region V were codon 273 mutations in cured patients, whereas three of four mutations were located in codon 273 in patients with metastatic disease. Allelic loss of p53 (loss of heterozygosity [LOH]) was demonstrated in 26% of the cured patients and in 39% of patients with metastatic disease (P = .36). The combination of mutation and LOH of p53 was the same (17%) in both groups.

CONCLUSION: A large number of p53 mutations in colorectal cancer do not promote disease progression. Some mutations, particularly within conserved regions, may even counteract negative functional effects of other p53 structural alterations. A complete loss of p53 function was not related to survival or progression after curative operation of colorectal carcinoma.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION REFERENCES

 
MUTATION IN THE p53 gene is one of the most frequent findings of structural alterations in human tumor DNA. Accordingly, studies on cell cultures of colorectal carcinomas^1,2 and knockout mice³ have provided evidence that allelic loss and mutant p53 lead to malignant transformation and perhaps disease progression usually in combination with other genetic alterations. However, clinical studies have not provided unanimous results demonstrating a role for p53 as a key factor in disease progression in patients with colorectal cancer. In some studies, p53 has been identified as an independent marker for prognosis of colorectal carcinoma,^4-7 whereas others have not been able to confirm this observation.^8,9 In fact, it has also been reported that p53 mutations may even improve outcome in colorectal cancer, at least in subgroups of patients.^10-12 In this context, we evaluated to what extent additional p53 mutations appeared in colorectal liver metastases from 41 patients when compared with the primary tumor in the same patient.¹³ The results indicated a trend to a significantly increased appearance of p53 mutations within exons and conserved domains in the p53 gene of metastatic tumor cells, findings that could be in line with a concept of further destabilization of p53 in association with the clinical appearance of metastatic disease. Our observed phenomenon may thus support a concept where destabilization of p53 increases the risk for tumor progression in patients, although such findings in general may alternatively be secondary to tumor cell DNA deterioration and further loss of major regulatory functions. Unexpectedly, however, we found that p53 mutations in either the primary tumor or in the subsequent metastatic hepatic lesion were related to improved survival after liver resection for the hepatic metastases from the primary colorectal cancer.¹³ Such observations may thus agree with previously reported findings by others that mutant p53 is not unanimously a negative factor to predict outcome in colorectal carcinoma.^10-12 It hence remains unclear to what extent p53 mutations determine worse prognosis and promote progression of colorectal carcinoma. In the present case control analysis we have, therefore, evaluated the occurrence of DNA sequence alterations of p53 in primary colorectal tumors from potentially cured patients compared with mutant p53 in primary colorectal carcinoma from patients with early metastatic disease of colorectal cancer.¹³

	PATIENTS AND METHODS

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION REFERENCES

 
Patients and Tumor Samples
Patients for the present analysis were selected from a cohort of approximately 3,000 patients to match our previous group of 41 patients with colorectal carcinoma who subsequently underwent hepatic resection because of liver metastases during 1983 to 1996 in Göteborg, Sweden.¹³ Patients for the present analysis were selected who had no clinical sign of tumor recurrence for more than 6 years after their primary operation for colorectal carcinoma (Fig 1). These patients were operated on at Sahlgrenska University Hospital, Göteborg, Sweden, between August 1980 and November 1992, with attempted curative resection for their primary tumors, and are referred to as potentially cured patients. Additional selection criteria were the anatomic localization (colon or rectum) of the primary tumors, Dukes’ cancer stage, age, and sex compared with the reference group of patients whose livers were resected for early recurrence of hepatic colorectal metastases. The reference patients are referred to as patients with early metastatic disease.

View larger version (14K): [in this window] [in a new window]   Fig 1. Time-course relapse (in months) or death in patients potentially cured () or with early metastatic disease (•). None of the potentially cured patients had any clinically evident relapse. P < .0001.

Details on clinical and p53 status in tumor DNA from reference patients are presented elsewhere¹³ and their p53 gene status is summarized in Table 1. In summary, sequencing analyses demonstrated mutation in exons 5 to 9 in 16 patients (41%). The mutations were most frequently observed in exon 8 (codon 263 and 273), exon 7 (codon 248), and exon 6 (codon 196); 77% were missense, 11% were nonsense, 5% were microinsertions, and 7% were silence. Sixty-four percent were base pair (bp) transitions mainly GA (29%) and CT (36%), whereas 36% mutations were transversion. None of the potentially cured patients or those with early metastatic disease had received any pre- or postoperative radiochemotherapy.

DNA Extraction
Paraffin-embedded tissue sections (25 µm) were deparaffinized in xylene and rehydrated in graded ethanol. Genomic DNA was subsequently extracted according to instructions in the QIAamp DNA mini kit (Qiagen, Santa Clarita, CA).

Polymerase Chain Reaction
Exons 5 to 9 of p53, corresponding to highly conserved regions of the gene, were selectively amplified by polymerase chain reaction (PCR) in a DNA thermocycler (Perkin-Elmer-Cetus, Gouda, the Netherlands). The primers used were included in the human p53 Amplimer panel (no. 6397-1) from Clontech Laboratories, Inc (Palo Alto, CA). For denaturing gradient gel electrophoresis analysis (DGGE), a 40-mer GC-rich sequence clamp was added to one of each primer pair.¹⁵

The sequence of the primers were as follows: for exon 5, 5' [GC]–CTC TTC CTG CAG TAC TCC CCT GC–3' and 5'–GCC CCA GCT GCT CAC CAT CGC TA–3'; exon 6, 5' [GC]–GAT TGC TCT TAG GTC TGG CCC CTC–3' and 5'–GGC CAC TGA CAA CCA CCC TTA ACC–3'; exon 7, 5' [GC]–GTG TTG TCT CCT AGG TTG GCT CTG–3' and 5'–CAA GTG GCT CCT GAC CTG GAG TC–3'; exon 8, 5' [GC]–ACC TGA TTT CCT TAC TGC CTC TGG C–3' and 5'–GTC CTG CTT GCT TAC CTC GCT TAG T–3'; and exon 9, 5' [GC]–GCC TCT TTC CTA GCA CTG CCC AAC–3' and 5'–CCC AAG ACT TAG TAC CTG AAG GGT G–3'.

Fifty microliters of reaction mixture contained 1 µg of genomic DNA, Tris HCl 10 mmol/L, KCl 50 mmol/L, MgCl₂ 1.5 mmol/L, 0.01% gelatin, 0.2 mmol/L of each deoxyribonucleotide triphosphates, 2.0 units of AmpliTaq DNA polymerase, 0.4 µmol/L of each primer, and sterile double destillated H₂O up to a 50-µL final concentration. The cycle condition was after a hot start: 35 cycles at 95°C for 30 seconds, 58°C for 30 seconds, and 72°C for 90 seconds, followed by 7 minutes at 72°C to ensure complete extension. A negative control containing no DNA template was included for each PCR amplification round. The PCR products were checked for proper length on a 2.7% agarose gel.

DGGE
DGGE electrophoresis was run on GC-clamped DNA fragments on a 10% polyacrylamide gel in 1 x Tris-acetate-EDTA-Buffer at 56°C, 150 V for 5 hours. The appropriate gradient of denaturants in the gel (100% is equal to 7 mol/L urea/40% formamide) was determined experimentally for every exon by perpendicular gradient gel electrophoresis.¹⁶ After electrophoresis, the gel was stained with ethidium bromide and photographed by ultraviolet transillumination. A mutation in the DNA fragment was detected as a deviant band(s) in the gel.

DNA Sequencing
DNA fragments showing abnormal mobility shift in the DGGE gel were amplified for direct sequencing. The same primers as for DGGE were used for sequencing, but the GC clamp was not added. The PCR product was purified from an agarose gel with the GFX PCR and gel band purification kit (Amersham Pharmacia Biotech Inc, Piscataway, NJ) before being added to the sequence reaction. Twenty microliters of reaction mix contained 15 to 100 ng of purified PCR product, 8 µL of BigDye Terminator cycle sequencing ready reaction mix (Perkin Elmer Applied Biosystems, Foster City, CA), 3.2 pmol of primer, and dH₂O. Amplification consisted of 25 rounds of thermal cycling (at 96°C for 30 seconds, 50°C for 15 seconds, and 60°C for 4 minutes). After ethanol precipitation, the samples were diluted in 12 µL of template suppression reagent and analyzed by an automated sequencer (ABI Prism 310 Genetic Analyzer; Perkin Elmer Applied Biosystems). Each sample was sequenced on both sense and antisense strands. Any mutation found was confirmed by a second sequencing procedure on new PCR products.

Loss of Heterozygosity
The polymorphism in codon 72 of p53, which substitutes an arginine (Arg) for proline (Pro), was examined for loss of heterozygosity (LOH). This was performed by amplification of a 196-bp fragment, which included the polymorphic site. The fragment was then cleaved by the restriction enzyme BstU1. An arginine in codon 72 will result in two smaller fragments of 100 bp and 96 bp. The following primers were used: 5'–CAATGGATGATTTGATGCTG–3' and 5'–TGGTAGGTTTTCTGGGAAGG–3'.¹⁷ The reaction mixture contained 0.2 to 1 µg of genomic DNA, Tris HCl 10 mmol/L, KCl 50 mmol/L, MgCl₂ 1.5 mmol/L, 0.01% gelatin, 0.2 mmol/L of each deoxyribonucleotide triphosphates, 2.0 units of AmpliTaq DNA polymerase, 0.4 µmol/L of each primer, 5% dimethyl sulfoxide, and sterile ddH₂O up to a 50-µL final concentration. DNA was added just before the cycling program after a hot-start procedure. After a 5-minute incubation at 94°C, the amplification cycles were as follows: 36 rounds at 94°C, 55°C, and 72°C for 30 seconds, 1 minute, and 1 minute, respectively. The amplification was ended with an elongation step at 72°C for 7 minutes.

Amplification products were checked for proper length on a 2.7% agarose gel before being cut by the restriction enzyme. The restriction reaction (12.5 µL of PCR, 1.6 µL of enzyme buffer, 0.9 µL of H₂O, and 1 µL [10 units] of BstU1) was incubated at 60°C for at least 1 hour. An additional reaction mixture with the same PCR product was prepared to control for proper restriction reactions by exchanging H₂O for 0.9 µL (250 ng) of pUC18 DNA (Boehringer Mannheim, La Jolla, CA). The samples were then run on a 10% Tris-Borate-EDTA-Buffer (Novex, Invitrogen Life technologies) polyacrylamide gel at 200 V for 1 hour 15 minutes.

Statistics
The main hypothesis was to evaluate whether potentially cured patients displayed a significant difference in p53 mutations (² test) compared with patients with early metastatic disease, according to the current concept on the role of p53 for tumor progression. The second aim was to test for differences in distribution frequency within exons and other DNA domains between the patient groups with the application of Fisher’s exact test when appropriate (² test). P values less than .05 were considered statistically significant and P < .10 was regarded as a statistical trend. Presentation of time to tumor relapse and survival time among patients were calculated by the Kaplan-Meier technique, and any differences were statistically tested by the log-rank Mantel-Cox technique (StatView 5.0; Abacus Concepts, Inc, Berkeley, CA). The statistical evaluation of DNA alterations has been developed during recent years. Therefore, we also evaluated our results on mutations in exons 5 to 9 using the approach described by Cariello et al.¹⁸ This technique is targeted for an evaluation of whether observed differences of mutations in analyzed DNA belong to the same population. Thus, the sophisticated technique by Cariello et al has the power to identify different patterns of DNA sequences and not just different overall frequencies.

	RESULTS

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION REFERENCES

 
A survival computation on the two patient groups (potentially cured v early metastatic) demonstrates that our patient selection procedure implemented as expected a dramatically shorter survival in the group with early clinical evidence of metastatic disease, whereas none of the patients classified as potentially cured had relapsed or died due to colorectal carcinoma within 6 to 8 years after surgery (Fig 1, P < .0001). However, two patients died from other malignancies 7 years after colorectal cancer surgery. It was also evident that the proportion of alive patients with early metastatic disease decreased constantly up to 40 to 45 months after their primary operation for colorectal carcinoma (Fig 2, P < .0001). Those patients with metastatic disease who did not relapse within 40 to 45 months after surgery may have belonged to a clinically different subgroup of patients, according to the apparent change in time-course recurrence beyond 45 months of observation time.

View larger version (14K): [in this window] [in a new window]   Fig 2. Survival curves (in months) for patients operated on for colorectal carcinoma and classified as potentially cured () or with early metastatic disease (•). Potentially cured patients who died between 65 and 85 months after their operation did not die from colorectal carcinoma. P < .0001.

View larger version (18K): [in this window] [in a new window]   Fig 3. The overall frequency of p53 mutations in various exons (5 to 9) in primary tumor DNA from potentially cured patients operated on for colorectal carcinoma compared with patients with early metastatic relapse.13

View larger version (9K): [in this window] [in a new window]   Fig 4. Distribution of conserved regions (I to V) compared with exons 2 to 11 in the p53 gene.

View larger version (21K): [in this window] [in a new window]   Fig 5. Distribution of p53 mutations among conserved regions in primary tumor DNA from potentially cured patients with colorectal carcinoma compared with patients with early metastatic relapse.13

Twenty-seven of the original 29 potentially cured patients were available for analysis of LOH because normal tissue was not found in two patients. Seven (26%) of the remaining patients had LOH. Of the 25 patients analyzed for mutation by DGGE and sequencing, 23 patients were available for LOH evaluation. All 27 patients were informative for LOH, which means that they were heterozygotes for the polymorphism examined. Four (17%) of 23 patients with a mutated p53 gene, and two of the patients without mutation showed LOH (Table 2). Twenty-nine of the 39 patients with metastatic disease were available for LOH analysis. Eighteen of them were informative, and seven (39%) of those 18 showed allelic loss. Three (17%) of 18 patients with allelic loss had a mutated p53 gene. There was no significant difference in the amount of allelic loss between the two groups (26% v 39%, P = .36). Thus, 17% of the patients, either potentially cured or with early metastatic disease, had biochemical evidence of a complete loss of p53 function (LOH plus mutations, Tables 1 and 2).

	DISCUSSION

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION REFERENCES

 
The present analysis challenges the concept that p53 mutations are an underlying mechanism in the rapid disease progression of colorectal cancer being an independent factor for survival after attempts of curative resection. Traditionally, these kinds of studies have been performed by analyses of biochemical findings in tumor material and subsequent survival analyses for all patients, including various estimates of prognostic items. Although this approach is scientifically straightforward, it usually demands a large number of patients and a long period of postoperative follow-up to identify and confirm that isolated biochemical alterations are prognostically useful. With the present design, we chose an alternative approach by starting with the clinical selection according to an extreme outcome between two patient groups and then evaluating how biochemical alterations emerged in the two groups of patients. Scientifically, this approach is not fundamentally different from the conventional approach. According to statistical logic, however, the present model should be more sensitive for preliminary identification of rather complicated relationships among biochemical variables and clinical outcome in a small number of patients.

The present evaluation was developed stepwise. First, we analyzed primary colorectal tumors from 41 consecutive patients who presented with early liver metastases during 1983 to 1996 in whom it was possible to perform radical hepatectomy according to clinical evaluation and standard surgical principles.¹³ These patients had thus relapsed with clinically visible metastases in either their right or left liver lobes only. All these patients with early hepatic metastatic disease were referred consecutively to our department and belonged to a cohort of 800 to 1,000 patients with metastatic progression for whom radical liver resection was not purposeful or deemed possible. According to clinical and tumor variables in the group of patients with metastatic disease, we then selected a subgroup of matched patients who seemed to be potentially cured of colorectal cancer. These patients were selected from approximately 3,000 patients operated on for primary colorectal carcinoma at Sahlgrenska University Hospital in Göteborg between 1980 and 1998. These patients had no evidence of relapse from their primary colorectal tumors. Thus, a majority of the current matched patients can be regarded as definitely cured by their primary operation as the only treatment option.

The results in the present analysis demonstrate that potentially cured patients showed a statistical trend (P < .07) to a different overall frequency of p53 mutations in exons 5 to 9 and a confirmed difference (P < .02) of mutations in conserved domains II to V compared with tumor DNA from patients with early metastatic spread evaluated by traditional ² statistics. Comparing the entire mutation spectra in exons 5 to 9 according to Cariello et al¹⁸ confirmed a statistical difference among p53 mutations in the two patient cohorts (P < .001). The p53 mutations within the two patient groups were similar both in the frequency and the type of mutations, as reported earlier in the literature from unselected patients with colorectal cancer. The mutation frequency outside conserved domains was lower among the potentially cured patients. Conceptually, this may suggest that the most harmful mutations were outside conservative domains and that p53 mutations in exons 5 to 9 may even introduce a gain of protective function. This conclusion is based on the observation of more p53 mutations in exons 5 and 8 in the tumor p53 gene from the potentially cured patients. The real meaning of this observation is unclear but may have several explanations. One may be that some mutations within p53 may potentiate native function related to the normal p53 protein,¹⁹ although most p53 mutations have been reported to abrogate wild-type p53 function according to basal cell work.²⁰ Some mutations in p53 have been reported to gain oncogenic function of the protein, evident in studies on p53 ablated cell lines.²¹ However, most interesting are the recent observations on genetic selection of intragenic suppressor mutations that may reverse effects of common p53 cancer mutations.²² Such observations imply that suppressor mutations, leading to p53 inactivation, could be functionally present in additional mutations by increasing the stability of the folded side of p53 or could introduce additional p53-DNA contact that would restore functional activity to subsets of tumor-derived mutants. Another more simple model to explain the observations in the cured patients with or without allelic loss of p53 would be that mutated p53 protein has altered binding or susceptibility of degradation by proteases leading to an increased intracellular stability for additional p53 protein, either wild-type or mutated.²³ This could promote intracellular ligand interactions within cells leading secondarily to a relatively prolonged exposure to wild-type p53 protein or to protein with partial p53 function when present. This speculative concept with increased stability of functional p53 is in line with findings of seeming overexpression of p53 in malignant tumors determined with immunohistochemical techniques, visualizing an abnormally and relatively increased proportion of p53 being truly mutated or not.

Another observation of interest with regard to the role of p53, in either disease progression or survival in colorectal cancer, is our finding of the combined appearance of allelic loss and mutant p53 in potentially cured patients, which should be equivalent to the biochemical evidence of an ablation of p53 function in the tumors. Our results show that only 17% of the patients, either potentially cured or with metastatic relapse, had ablated p53 function. It is presently not known to what extent a heterozygote-intact p53 gene can compensate for a mutated or lost allele during prolonged time periods, particularly in cells under functional stress. Such compensatory mechanisms could be gene amplification, transcription upregulation of the remaining allele, or simply facilitated catalytic activation of the native p53 protein. Regardless, our results suggest that complete loss of p53 function is not responsible for reported relationships between p53 alterations and progression of colorectal cancer. Thus, such a relationship should rather represent a gain of function, introduced by mutation protein alterations, explaining reported cellular dysfunction related to p53 in colorectal carcinoma.

In conclusion, the present case-control analysis demonstrates that reported results on the overall frequencies of mutant p53 in colorectal cancer are hampered by the fact that a variety of mutations may or may not have negative functional implications; some mutations may even counteract negative functional effects of structural p53 alterations.²¹ It is also obvious that a majority of p53 mutations occurred without the presence of allelic loss, an observation which in itself may not be compatible with loss of p53 function implied from basal cell work, and by the fact that all our present patients, with either mutant p53, LOH, or the combination of both, were potentially cured. Thus, our results demonstrate that a complete loss of p53 function can be compatible with either cure or early relapse of metastatic disease. However, isolated mutations outside exons and conservative domains may still be relevant for prognosis compared with mutations (exons 5 to 9) preferentially studied and evaluated in most published reports.^24-26 The results in the present clinical analysis give statistical support to previously published experimental observations that suppressor mutations can override other p53 alterations eventually related to cancer progression.²²

	ACKNOWLEDGMENTS

 
Supported in part by grant nos. 2014-B99-13XBC from the Swedish Cancer Society and K2000-72X-08712-12B from the Swedish Medical Research Council, Tore Nilson Foundation, Assar Gabrielsson Foundation (AB Volvo), Jubileumskliniken Foundation, IngaBritt and Arne Lundberg Research Foundation, Swedish and Göteborg Medical Societies, and the Medical Faculty, Göteborg University, Sweden.

	REFERENCES

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION REFERENCES

 
1. Pocard M, Chevillard S, Villaudy J, et al: Different p53 mutations produce distinct effects on the ability of colon carcinoma cells to become blocked at the G1/S boundary after irradiation. Oncogene 12: 875-882, 1996[Medline]

2. Baker SJ, Markowitz S, Fearon ER, et al: Suppression of human colorectal carcinoma cell growth by wild-type p53. Science 249: 912-915, 1990[Abstract/Free Full Text]

3. Donehower LA, Harvey M, Slagle BL, et al: Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 356: 215-221, 1992[Medline]

4. Kressner U, Inganas M, Byding S, et al: Prognostic value of p53 genetic changes in colorectal cancer. J Clin Oncol 17: 593-599, 1999[Abstract/Free Full Text]

5. Nitti D, Belluco C, Montesco MC, et al: Nuclear p53 protein expression in resected hepatic metastases from colorectal cancer: An independent prognostic factor of survival. Eur J Cancer 34: 851-855, 1998

6. Goh HS, Yao J, Smith DR: p53 point mutation and survival in colorectal cancer patients. Cancer Res 55: 5217-5221, 1995[Abstract/Free Full Text]

7. Hamelin R, Laurent-Puig P, Olschwang S, et al: Association of p53 mutations with short survival in colorectal cancer. Gastroenterology 106: 42-48, 1994[Medline]

8. Bosari S, Viale G, Roncalli M, et al: p53 gene mutations, p53 protein accumulation and compartmentalization in colorectal adenocarcinoma. Am J Pathol 147: 790-798, 1995[Abstract]

9. Grewal H, Guillem JG, Klimstra DS, et al: p53 nuclear overexpression may not be an independent prognostic marker in early colorectal cancer. Dis Colon Rectum 38: 1176-1181, 1995[Medline]

10. Adrover E, Maestro ML, Sanz-Casla MT, et al: Expression of high p53 levels in colorectal cancer: A favourable prognostic factor. Br J Cancer 81: 122-126, 1999[Medline]

11. De Jong KP, Stellema R, Karrenbeld A, et al: Clinical relevance of transforming growth factor alpha, epidermal growth factor receptor, p53, and Ki67 in colorectal liver metastases and corresponding primary tumors. Hepatology 28: 971-979, 1998[Medline]

12. Soong R, Grieu F, Robbins P, et al: p53 alterations are associated with improved prognosis in distal colonic carcinomas. Clin Cancer Res 3: 1405-1411, 1997[Abstract]

13. Yang Y, Forslund A, Remotti H, et al: p53 mutations in primary tumors and subsequent liver metastases are related to survival in patients with colorectal carcinoma who undergo liver resection. Cancer 4: 727-736, 2001

14. Dukes CE, Bussey HJR: The spread of rectal cancer and its effect on prognosis. Br J Cancer 12: 309-320, 1958[Medline]

15. Sheffield VC, Cox DR, Lerman LS, et al: Attachment of a 40-base-pair G + C-rich sequence (GC-clamp) to genomic DNA fragments by the polymerase chain reaction results in improved detection of single-base changes. Proc Natl Acad Sci U S A 86: 232-236, 1989[Abstract/Free Full Text]

16. Andersen TI, Borresen AL: Alterations of the TP53 gene as a potential prognostic marker in breast carcinomas: Advantages of using constant denaturant gel electrophoresis in mutation detection. Diagn Mol Pathol 4: 203-211, 1995[Medline]

17. Olschwang S, Laurent-Puig P, Vassal A, et al: Characterization of a frequent polymorphism in the coding sequence of the Tp53 gene in colonic cancer patients and a control population. Hum Genet 86: 369-370, 1991[Medline]

18. Cariello NF, Piegorsch WW, Adams WT, et al: Computer program for the analysis of mutational spectra: Application to p53 mutations. Carcinogenesis 15: 2281-2285, 1994[Abstract/Free Full Text]

19. Crook T, Parker GA, Rozycka M, et al: A transforming p53 mutant, which binds DNA, transactivates and induces apoptosis reveals a nuclear: Cytoplasmic shuttling defect. Oncogene 16: 1429-1441, 1998[Medline]

20. Nagata Y, Anan T, Yoshida T, et al: The stabilization mechanism of mutant-type p53 by impaired ubiquitination: The loss of wild-type p53 function and the hsp90 association. Oncogene 18: 6037-6049, 1999[Medline]

21. Dittmer D, Pati S, Zambetti G, et al: Gain of function mutations in p53. Nat Genet 4: 42-46, 1993[Medline]

22. Brachmann RK, Yu K, Eby Y, et al: Genetic selection of intragenic suppressor mutations that reverse the effect of common p53 cancer mutations. EMBO J 17: 1847-1859, 1998[Medline]

23. Lane DP, Hall PA: MDM2: Arbiter of p53’s destruction. Trends Biochem Sci 22: 372-374, 1997[Medline]

24. Caldes T, Iniesta P, Vega FJ, et al: Comparative survival analysis of p53 gene mutations and protein accumulation in colorectal cancer. Oncology 55: 249-257, 1998.[Medline]

25. Kahlenberg MS, Stoler DL, Rodriguez-Bigas MA, et al: p53 tumor suppressor gene mutations predict decreased survival of patients with sporadic colorectal carcinoma. Cancer 88: 1814-1819, 2000[Medline]

26. Iniesta P, Vega FJ, et al: p53 exon 7 mutations as a predictor of poor prognosis in patients with colon cancer. Cancer Lett 130: 153-160, 1998[Medline]

Submitted September 19, 2000; accepted February 21, 2001.

This article has been cited by other articles:

				A B Hassan and C Paraskeva Colorectal cancer prognosis: is it all mutation, mutation, mutation? Gut, September 1, 2005; 54(9): 1209 - 1211. [Abstract] [Full Text] [PDF]

				F. Graziano and S. Cascinu Prognostic molecular markers for planning adjuvant chemotherapy trials in Dukes' B colorectal cancer patients: how much evidence is enough? Ann. Onc., July 1, 2003; 14(7): 1026 - 1038. [Abstract] [Full Text] [PDF]

				M.-C. Etienne, M. Chazal, P. Laurent-Puig, N. Magne, C. Rosty, J.-L. Formento, M. Francoual, P. Formento, N. Renee, E. Chamorey, et al. Prognostic Value of Tumoral Thymidylate Synthase and p53 in Metastatic Colorectal Cancer Patients Receiving Fluorouracil-Based Chemotherapy: Phenotypic and Genotypic Analyses J. Clin. Oncol., June 15, 2002; 20(12): 2832 - 2843. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Services Email this article to a colleague Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Save to my personal folders Download to citation manager Rights & Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Forslund, A. Articles by Lundholm, K. Search for Related Content PubMed PubMed Citation Articles by Forslund, A. Articles by Lundholm, K.