Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cabelguenne, A.
Right arrow Articles by Laurent-Puig, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cabelguenne, A.
Right arrow Articles by Laurent-Puig, P.
Journal of Clinical Oncology, Vol 18, Issue 7 (April), 2000: 1465-1473
© 2000 American Society for Clinical Oncology

p53 Alterations Predict Tumor Response to Neoadjuvant Chemotherapy in Head and Neck Squamous Cell Carcinoma: A Prospective Series

By Arnauld Cabelguenne, Hélène Blons, Isabelle de Waziers, Françoise Carnot, Anne-Marie Houllier, Thierry Soussi, Daniel Brasnu, Phillipe Beaune, Ollivier Laccourreye, Pierre Laurent-Puig

From the Laboratoire de Toxicologie Moléculaire, L’Institut National de la Santé et de la Recherche Médicale; Génotoxicologie et Modulation de l’Expression Génique, Laboratoire d’Anatomo-Pathologie; Service d’Oto-Rhino-Laryngologie et de Chirurgie Cervico-Faciale; Service de Chirurgie Générale Digestive et Oncologique Assistance Publique-Hopitaux de Paris, Université-Paris V, Paris, France.

Address reprint requests to Philippe Beaune, MD, Laboratoire de Toxicologie Moléculaire, L’Institut National de la Santé et de la Recherche Médicale, U490 Faculté de Médecine des Saints Pères, 45 Rue des Saints Pères, 75270 Paris, Cedex 06, France; email Pierre.Laurent-Puig{at}biomedicale.univ-paris5.fr


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
PURPOSE: The tumor suppressor gene p53 plays a crucial role in cell cycle control and apoptosis in response to DNA damages. p53 gene mutations and allelic losses at 17p are one of the most common genetic alterations in primary head and neck squamous cell carcinoma (HNSCC). Alterations of the p53 gene have been shown to contribute to carcinogenesis and drug resistance.

PATIENTS AND METHODS: In this prospective series, patients with HNSCC were treated with cisplatin-fluorouracil neoadjuvant chemotherapy. p53 status was characterized in 106 patients with HNSCC (p53 mutations, allelic losses at p53 locus, and plasma anti-p53 antibodies) to determine the existence of a relationship between p53 gene status and response to neoadjuvant chemotherapy.

RESULTS: Exons 4 to 9 of the p53 gene were analyzed, and mutations were found in 72 of 106 patients with HNSCC. p53 mutations were associated with loss of heterozygosity at chromosome 17p (P < .001). The prevalence of p53-mutated tumors was higher in the group of patients with nonresponse to neoadjuvant chemotherapy than in the group of responders (81% v 61%, respectively; P < .04). When compiling p53 mutations and anti-p53 antibodies in plasma, the correlation between p53 status and response to chemotherapy was significant (87% v 57%, respectively; P = .003). A multivariate analysis showed that p53 status is an independent predictive factor of response to chemotherapy.

CONCLUSION: This prospective study suggests that p53 status may be a useful indicator of response to neoadjuvant chemotherapy in HNSCC.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
HEAD AND NECK cancer accounts for 5% of all new cancer cases in the Western world each year. Despite conventional treatment with surgery and radiotherapy, the prognosis of patients with advanced head and neck tumors remains unchanged, and both treatments may be associated with strong functional morbidity that dramatically affects the patients’ quality of life. New treatment strategies have been developed that include neoadjuvant chemotherapy. The combination of cisplatin and fluorouracil (5-FU) is considered to be the standard regimen of neoadjuvant chemotherapy for patients with HNSCC.1 Randomized trials that evaluate its role show objective response rates of approximately 70% and complete responses that range from 14% to 31%. This regimen of neoadjuvant chemotherapy does not improve survival but seems to be valuable in terms of organ preservation strategies.2-7 Understanding the different mechanisms that contribute to resistance to chemotherapy in HNSCC is still a challenge because the only factors actually linked to the response are tumor size and nodal extension.8,9

Cells can escape drug cytotoxicity in different ways: some prevent active agents from causing cell damage, whereas others prevent cell death after DNA damage. Recently, advances in fundamental research have shown that numerous biologic markers, especially the p53 protein,10 could be related to antineoplastic drug cytotoxicity. p53 modulates a number of cellular responses to genotoxic stress and plays a crucial role in cell cycle checkpoint control and in the regulation of apoptosis.11 In tumor cells, the enhancement of p53 expression has been demonstrated after exposure to anticancer agents, which suggests its role in triggering cellular responses to these drugs.12 In tumor cells, loss of p53 function has been linked to resistance to chemotherapy, and mutant p53 could prevent cells from undergoing apoptosis induced by cytotoxic agents.13-15 In addition, adenovirus-mediated transfer of the wild-type p53 gene into human cell lines with homozygous deletion of p53 significantly increases their sensitivity to cisplatin.16 In vivo p53 alterations have been related to resistance to a wide range of chemotherapy agents, including doxorubicin in breast cancer,17,18 cisplatin in ovarian19 and esophageal cancers,20 and 5-FU in colorectal carcinoma.21 The incidence of p53 gene mutations associated with allelic loss at 17p is one of the most common genetic abnormalities in HNSCC.22 However, the influence of disrupted p53 functions on resistance to chemotherapy has not been studied in HNSCC.

In this study, for the first time, molecular and serologic analyses of p53 alterations were performed to correlate the response to the neoadjuvant 5FU-cisplatin regimen and p53 alterations on a large prospective series of 106 patients with primary HNSCC who were undergoing cisplatin–5-FU neoadjuvant chemotherapy. The p53 alteration status was determined by (1) the loss of heterozygosity (LOH) at 17p with two microsatellite markers flanking the p53 locus, (2) the existence of p53 mutations in exons 4 to 9 in tumor DNA, and (3) the presence of anti-p53 antibodies in plasma.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Patients
All patients older than 18 years with histologically proven HNSCC and without (1) previous history of cancer, (2) multiple tumor locations, or (3) contraindication for cisplatin-based neoadjuvant chemotherapy were eligible for entry onto the study. Tumor stage was not considered in the inclusion criteria in this series. A total of 106 patients (92 males, 14 females; mean age ± SD, 59 ± 5.5 years) who were managed at Laennec Hospital in Paris between June 1996 and December 1997 were included after informed consent was obtained. The present prospective study was performed in agreement with French law and the authorization of the local ethic committee: Consultative Committee Protecting Persons in Biomedical Research, # 96,017. All patients received chemotherapy regimens that were given as neoadjuvant treatment before surgery or radiotherapy and that consisted of cisplatin (25mg/m2/d) and 5-FU (1g/m2/d) delivered as a daily continuous IV dosage in 4-day courses. Three courses were planned to be taken before surgery or radiotherapy. Tumors were grouped according to the tumor-node-metastasis classification and staged as recommended by the American Joint Committee on Cancer.23 According to tumor size (T) and nodal status (N), three tumors were T1, 42 were T2, 25 were T3, 36 were T4, 50 were N0, 19 were N1, 28 were N2, and nine were N3. Two tumors were classified as stage I, 27 as stage II, 23 as stage III, and 54 as stage IV. Cycles of chemotherapy were repeated at 16- to 21-day intervals for three courses. A work-up with endoscopy and computed tomography scan allowed the assessment of clinical response as defined by the Eastern Cooperative Oncology Group.24 A complete response was defined as the disappearance of tumor, and a partial response was defined as an at least 50% decrease in size of the lesion. A no change status was defined as no significant change in size of the lesion or a less than 50% decrease. Progressive disease was defined as a greater than 25% increase in the size of the lesion. Patients were assigned to one of two groups according to their clinical response to chemotherapy after three courses: responders with complete or partial response (n = 69) and nonresponders (n = 37). All data from patients were reviewed by two of the authors (O.L. and D.B.) without knowledge of p53 status.

Samples Collection
Tumor biopsies and 10 mL blood samples were collected at the time of initial diagnosis during endoscopy under general anesthesia.

Blood samples. Blood was collected in ethylenediaminetetra-acetate tubes and centrifuged at 3,000 x g for 10 minutes to collect plasma. Plasma and lymphocytes were separated by 10 minutes of centrifugation at 3000 x g.

Tissue samples. All collected samples were immediately stored at -20°C, then snap frozen in liquid nitrogen within 2 hours after collection of tumor biopsy.

DNA extraction. Lymphocyte DNA was isolated from whole blood by use of the Wizard extraction kit (Promega, Charbonnières, France). Tumor samples were pulverized in liquid nitrogen and placed in dodecyl sulfate/proteinase K. DNA was obtained by phenol/chloroform extraction and ethanol precipitation.

p53 Mutations Screening
Polymerase chain reaction (PCR) amplification. Exons 4 to 8 were screened for mutations by use of denaturing gradient gel electrophoresis (DGGE) in accordance with the method described by Hamelin et al25 for exons 5, 7, and 8 and the method of Guldberg et al26 for exons 4 and 6. Exon 9 was screened for mutations by the latter method using the following primers: forward ATCACCTTTCCTTGCCTCTT and reverse TGATAAGAGGTCCCAAGACT. A GC clamp was added to the reverse primer: CCCCACGCCACCCGACGCCCCAGCCCGACCCCCCCGCGCCCGGCGCCCCCGC.

Reactions were carried out using 50 ng of genomic DNA-containing buffer: 1 x 1.5 mmol/L MgCl2, 200 µmol/L DNTP, 0.3 µmol/L of each primer, and 0.5 units of AmpliTaq polymerase Cetus (Perkin-Elmer, Courtaboeuf, France) as template in final volume of 25 µL. Cycling conditions were as follows: initial denaturation for 10 minutes at 94°C followed by 35 cycles of 94°C for 30 seconds, annealing temperatures for 1 minute (Table 1), and 72°C for 1 minute 30 seconds. The final cycle was 72°C for 7 minutes, 98°C for 10 minutes, and annealing temperatures (Table 1) for 30 minutes to induce heteroduplex formation.


View this table:
[in this window]
[in a new window]
 
Table 1. Experimental Conditions for DGGE on Exons 4 to 9 of p53
 
DGGE. PCR products were loaded onto a 6.5% polyacrylamide gel that contained appropriate gradient of urea and formamide. Gradient concentrations and running conditions for each p53 exon are indicated in Table 1. After electrophoresis, gels were stained with ethidium bromide.

Mutation sequencing. Tumors that showed an electrophoretic variant pattern were amplified and sequenced for each variant exon. PCR products were purified with QIAquick PCR Purification Kit (QIAGEN S.A., Courtaboeuf, France) and sequenced on both strands on an ABI 310 genetic analyzer (PE Applied Biosystems, Courtaboeuf, France). We used a Big Dye Terminator sequencing kit (PE Applied Biosystems) according to the manufacturer’s instructions followed by ethanol precipitation to remove nonincorporated dyes. Sequences were analyzed by Sequence Analysis 3.0 (PE Applied Biosystems).

LOH Analysis
Two dinucleotide repeat markers (polyCA) that flanked the p53 gene (D17S849 and D17S786) were used to determine the allelic imbalance at this locus. Each microsatellite marker was amplified independently. PCRs were run at an annealing temperature of 55°C in a reaction volume of 20 µL in the following conditions: 1.5 mmol/L MgCl2, 1 times buffer, 0.2 mmol/L DNTP, 0.3 µmol/L each of forward and reverse primers, 0.5 units of Amplitaq polymerase Cetus (Perkin Elmer, St Quentin en Yvelines, France), and 50 ng of DNA. PCR products were diluted 1:3 in a loading buffer, 6 µL of which was subjected to electrophoresis on 6% polyacrylamide gels (7 mol urea and 32% [volume per volume] formamide; acrylamide to bisacrylamide ratio, 29:1) and then transferred by capillary blotting onto a nylon membrane. Membranes were hybridized with a 24mer polyCA probe labeled with alpha-32PdCTP. Membranes were exposed to X-OMAT films (Eastman Kodak, Rochester, NY), autoradiographs were analyzed by two independent readings, and LOH was scored visually by comparison of the allelic ratios in lymphocyte and tumor DNA. Markers were considered informative when they demonstrated heterozygosity.

Detection of p53 Antibody
Plasma was analyzed with the observer blinded to patient status. All plasma was tested for p53 antibodies by the enzyme-linked immunoadsorbent assay procedure that has been previously described.27 Briefly, all plasma was tested with two antigen preparations: one with p53 and one without. A total of 100 µL of plasma (diluted 1:100 in phosphate-buffered saline, 5% dried nonfat milk) was tested in duplicate. The results were expressed for each plasma sample as the ratio between the mean absorbance (optical density at 450 nm) value of the two wells with p53 and that of the corresponding wells without p53. Plasma devoid of p53 antibodies was previously shown to give similar signals in the two extracts, leading to a p53 to control ratio of near 1.0. This ratio is independent of the background of the plasma. Positive and negative plasma samples were randomly chosen and analyzed by immunoprecipitation to confirm their status.

Statistical Analysis
The {chi}2 test was used to determined differences in prevalence of genetic abnormalities among different patient populations, tumor stages, and disease sites. The t test was used to compare age among different patient populations. A logistic regression was used to analyze the contribution of patient tumor parameters to a classification in two groups, responders and nonresponders.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
p53 Mutation Analysis
A series of 106 patients with HNSCC were screened for p53 mutations in exons 4 to 9 using DGGE and sequencing analysis. All samples that presented abnormal electrophoretic mobility were sequenced. Seventy-two tumors were found mutated at p53. Among the 69 tumors in which mutation was characterized by sequencing, seven presented two different p53 mutations. In three cases we were unable to identify the nucleotide variation by sequencing, so these tumors were considered as mutated for the following analysis. Point mutations, deletions, and insertions were found in 60, 12, and four cases, respectively. These alterations represent 37 missenses, 12 nonsenses, 15 frameshifts, and one in-frame deletion. Eleven mutations affected splice site. Ten mutations were located in exon 4, 15 in exon 5, 12 in exon 6, 12 in exon 7, 15 in exon 8, and one in exon 9. The base substitutions consisted of 27 transversions and 33 transitions. Eleven of the 33 transitions were located in CpG sites (Table 2).


View this table:
[in this window]
[in a new window]
 
Table 2. Characterization of Different p53 Mutations Found in Head and Neck Cancer Patients Described
 

View this table:
[in this window]
[in a new window]
 
Table 2. Cont’d
 
Allelic Losses on Chromosome 17
Microsatellites (D17S849 and D17S786) were typed in tumor and normal DNA. These markers bordered the p53 locus. LOH at the p53 locus was considered in three cases. In the first case, the two markers (D17S849 and D17S786) demonstrated LOH (27 tumors). In the second case, one of the two markers demonstrated LOH and the other was not informative (18 tumors). In the third case, D17S786 demonstrated LOH, whereas D17S849 demonstrated a retention of heterozygosity (two tumors). The proximity of D17S786 to the p53 locus led us to attribute the status of D17S786 to the p53 locus. Of the 87 tumors considered informative, 47 demonstrated LOH at the p53 locus (54%). When tumors with two p53 mutations were excluded from analysis, p53 gene mutations were found in 80% of the patients with LOH at the p53 locus, whereas only 42% of the patients with tumors without LOH showed evidence of p53 mutations (P < .001).

Relationship Between p53 Status and Clinical Data
Patients and tumors were classified according to various parameters, including sex, stage, tumor size, nodal status, and localization. No correlation was found between p53 mutation status and sex or between p53 mutation status and stage, tumor size, localization, or nodal status. Finally, the mean age of the patients with p53-mutated tumors was not statistically different from that of patients with nonmutated tumors (Table 3).


View this table:
[in this window]
[in a new window]
 
Table 3. Relationship Between p53 Status and Clinical Data
 
Genetic Alterations and Response to Neoadjuvant Chemotherapy
p53 mutations and allelic losses on chromosome 17. Each patient was classified according to clinical response to chemotherapy after three courses of 5-FU–cisplatin regimen and assigned to one of two groups. p53 mutations were identified in 42 (61%) of 69 tumors collected from responders and in 30 (81%) of 37 tumors collected from nonresponders, a difference that is statistically significant (P = .034). In this prospective study, the surgeons identified, among the partial responders, a group of patients (n = 24) who achieved an almost complete response. When these patients were pooled with those who reached a complete response and the combined group was compared to the others, the relationship between the presence of a p53 mutation in tumor DNA and a low response to chemotherapy became more significant (P values varied from .034 to .013). Concerning LOH, the prevalence of losses at the p53 locus was higher in the group of nonresponders 62.5% (20 of 32) than in responders 49% (27 of 55), but this difference was not significant. The number of genetic events on chromosome 17 was calculated by adding the allelic p53 status and the p53 mutation status. Indeed, it has been largely demonstrated that the inactivation of tumor suppressor genes is associated with alterations of both alleles. We were interested in interpreting response to chemotherapy according to the number of p53 alterations. Patients were assigned to one of two groups according to the number of p53 genetic alterations present in each. The prevalence of nonresponders (40%) in the group of patients with one or two alterations at the p53 locus (ie, LOH and/or mutation or two mutations) was twice that of the group for whom no alterations at the p53 locus were found (20%). However, this difference did not reach significance (P < .08).

Type and localization of p53 mutations and response to chemotherapy. No correlation was observed between the type of mutation (ie, nonsense v missense mutation) and the response. Although no significant correlation was observed between the localization of mutation within the p53 gene and response status to chemotherapy, it was observed that only 22% of the patients with tumors mutated in the evolutionary conserved domain III (exon 5) were classified in the group of complete responders or almost complete responders. Furthermore, missense mutations that involved the L2 domain were related to a lower prevalence of complete or almost complete response compared with missense mutations located outside this domain (54% v 91%, respectively; P = .053, Fisher’s exact test). These residues contribute to the stabilization of the three-dimensional structure of the protein.

Anti-p53 antibodies in the plasma of patients and response to chemotherapy. The prevalence of anti-p53 antibodies in patient plasma was 17%. Four patients had plasma p53 antibodies, whereas no p53 mutations could be detected by DGGE screening. An immunohistochemistry detection of p53 was performed with D07 antibodies for these four tumor patients and was positive in all cases. All patients but one were nonresponders. When compiling p53 mutations and anti-p53 antibodies in plasma, the correlation between p53 status and response to chemotherapy was more significant than that observed when taking into account only p53 mutation analysis (87% v 57%; P < .003).

Multivariate Analysis
Although univariate analysis failed to demonstrate a significant link between response to chemotherapy and tumor size or nodal status (Table 4), multivariate analysis was performed to test the relative weight of each variable in the determination of the chemotherapy response. We considered tumor stage as a variable in this analysis because tumor size and nodal status are linked together (P = .006; data not shown). Two types of analysis were performed, one that used a multivariate logistic model that included p53 mutation as a variable and one that considered a new variable, p53 alteration, that was generated from data that associated p53 mutations and/or p53 antibodies in patient plasma. As listed in Tables 5 and 6, only p53 mutation or p53 alterations demonstrated an independent value to classify the patients according to their response to chemotherapy. Patients with tumors that demonstrated p53 mutation or alterations had relative risk of nonresponse values of 2.7 and 4.9, respectively.


View this table:
[in this window]
[in a new window]
 
Table 4. Relationship Between Response to Chemotherapy and Clinical Data
 

View this table:
[in this window]
[in a new window]
 
Table 5. Model 1: Logistic Regression Including Stage and p53 Mutation
 

View this table:
[in this window]
[in a new window]
 
Table 6. Model 2: Logistic Regression Including Stage and p53 Alteration
 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this prospective series, we analyzed 106 HNSCC samples collected from patients undergoing neoadjuvant chemotherapy. We used the DGGE method to identify tumors that contained p53 mutations. This method has a sensitivity and a specificity of approximately 90% in detecting mutations confirmed by DNA sequencing.25 In this series, a high prevalence of p53 mutations (68%) was found in exons 4 to 9. Most studies in the literature screened p53 from exons 5 to 8 and demonstrated a lower percentage of mutations.28,29 The prevalence of mutations in this series would have been 58% if exons 5 to 8 had been taken into account, in accordance with previously published results.30-32 Seven tumors were found to harbor two different p53 mutations. For these tumors, no allelic loss on the p53 locus was observed, which suggests that each allele carried a mutation and that this resulted in the inactivation of both alleles. In three tumors, although DGGE variant profiles suggested the presence of a mutation, it was not possible to characterize the mutation by sequencing. Because of the difference in sensitivity between DGGE and sequencing, the inability to identify the nucleotide mutations can be explained by the contamination of tumor samples by normal cells. Moreover, no allelic loss was observed in these three tumors.

Among the 76 identified mutations, 49% were missense mutations, 16% nonsense mutations, 21% deletions or insertions, and 14% splice junction mutations. As already shown, a high prevalence of microdeletion or insertion in HNSCC was found compared with other tumor types.32 Furthermore, the prevalence of nonsense mutations was higher than that found in previously published series. This high prevalence was in part a result of a high frequency of nonsense mutations in exon 4, which accounted for 42% of nonsense mutations. This is in accordance with the study of Greenblatt et al,33 which showed that p53 mutations outside exons 5 to 8 essentially generate stop codon or frameshift. The type and distribution of the mutations in the p53 gene are close to what has been published previously on HNSCC, if the discrepancy resulting from exon 4 is eliminated.34

A correlation was found between the absence of response to chemotherapy and the presence of p53 mutations in tumor DNA. This correlation was observed when all partial responder patients were classified as responders. However, the ultimate purpose of this study was to find predictive markers of response to chemotherapy in HNSCC to allow a priori selection of a subgroup of patients who would actually benefit from chemotherapy. Toward this goal, the head and neck surgeons identified among the group of partial responders at the time of control endoscopy a subgroup of 24 patients who achieved an almost complete response. When the analysis of the relationship between the response to neoadjuvant chemotherapy and p53 mutations in tumor DNA was made by regrouping the complete responders and the almost complete responders together and comparing them with the remaining patients, the results became more significant, with P values varying from .035 to .013. Such a correlation might be of interest to clinicians when they consider organ preservation strategy.

No correlation was found between tumor size or nodal tumor status and the presence of p53 mutations in tumor DNA, which indicates that tumor factors could affect tumor sensitivity to chemotherapy regardless of tumor staging. This has been confirmed by a multivariate analysis that showed that p53 mutation status is, regarding tumor stage, an independent factor of nonresponse.

Cisplatin and 5-FU, as anticancer drugs, are efficient because they alter DNA directly or indirectly and because they promote apoptosis in tumors cells.12,35 It has been demonstrated in vitro that failure in p53 apoptotic response leads to cisplatin resistance.15,36,37 A mouse model study has shown that p53 mutated tumors demonstrate a decreased response to radiotherapy or chemotherapy.13,14 In human studies, it has been shown in esophageal cancers20 that p53 mutations are significantly associated with a poorer re-sponse to chemotherapy- (5-FU, cisplatin, and interferon alfa) radiotherapy association. Furthermore, in colorectal cancers, p53 mutations seem to lead to 5-FU–based chemotherapy resistance.21,35

However, the mechanisms that underlie such relationships are not clear. Indeed, similar prevalence of low responders is found in patients with nonsense or frameshift p53-mutated tumors and in patients with missense p53-mutated tumors. This suggests that loss of normal p53 function is not critical to explaining the relationship between p53 mutations and poor response to chemotherapy. In fact, the correlation observed between low response to chemotherapy and p53 mutation status could be a result of a gain of function of mutant p53.38 Mutations of p53 can be classified in two groups according to the mechanism by which they affect the sequence-specific DNA-binding activity of p53. Schematically, one group of mutations involves DNA contact residues and provides p53 with a gain of function.38-40 The other group of p53 mutations alters residues that are involved in protein stability. For this group, alterations in the three-dimensional structure of p53 protein10 lead to a loss of function of p53. In breast cancer patients, p53-specific DNA-binding site mutations have been related to resistance to antitumor therapies.17,18 However, in our series, no relationship between response to chemotherapy and p53 mutation type or localization within the gene was observed. Furthermore, it is worth noting that p53 mutations of the same type do not necessarily lead to similar responses to chemotherapy, as is evident in the dramatic differences in tumor size reduction among patients. Thus, response to chemotherapy (cisplatin and 5-FU) could be driven by additional parameters in HNSCC. Among them, glutathione,41 exportation of GSH-cisplatin complex by the multidrug-resistant associated protein,42 and inactivation by metallothionein43 could participate in the metabolic inactivation of cisplatin. Furthermore, 5-FU metabolizing enzyme activities could influence the response to chemotherapy.44,45

To our knowledge, this study was the first in which molecular and serologic analyses of p53 were performed simultaneously on a large series of patients. The origin of anti-p53 antibodies has been a matter of debate for a long time.46,47 It has been shown that p53 accumulation is an important requisite for triggering immune response. Furthermore, it has been suggested that only mutations in exon 5 could lead to anti-p53 antibodies. In the present study, we show that the localization of the mutations within the gene is not an important factor in the appearance of these antibodies, because mutations associated with plasma p53 antibodies are dispersed in the various exons of the p53gene. This observation suggests that triggering immune response toward mutant p53 is a complex event that depends on several parameters that remain to be discovered. Because the presence of anti-p53 antibodies is closely related to the presence of p53 mutations in the core domain of the protein,48 we had to pool patients with p53 mutations found in tumor DNA by DGGE screening and those with only anti-p53 antibodies in their serum. In this case, the correlation between p53 status (mutations or anti-p53 antibodies) and response to chemotherapy was more reinforced than that observed between p53 mutation alone and response to chemotherapy.

This prospective study confirms the importance of p53 mutation detection in vivo, because the presence of a mutated p53 gene in tumor DNA is an independent predictive factor of low response to 5-FU–cisplatin chemotherapy in HNSCC. The absence of correlation between type or localization of mutations within the gene and response to chemotherapy may be a result of mechanisms that are more complex than simple gains or losses of p53 function, and further investigation is needed. However, the discovery of such predictive parameters would allow the optimization of patient treatment.


    ACKNOWLEDGMENTS
 
Supported by the Comité de Paris de la Ligue Nationale Contre le Cancer, Association Pous la Recherche Contre le Cancer, and Region Ile de France.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Catimel G: Head and neck cancer: Guidelines for chemotherapy. Drugs 51:73-88, 1996[Medline]

2. Kish JA, Ensley JF, Jacobs J, et al: A randomized trial of cisplatin (CACP) + 5-fluorouracil (5-FU) infusion and CACP + 5-FU bolus for recurrent and advanced squamous cell carcinoma of the head and neck. Cancer 56:2740-2744, 1985[Medline]

3. Thyss A, Schneider M, Santini J, et al: Induction chemotherapy with cis-platinum and 5-fluorouracil for squamous cell carcinoma of the head and neck. Br J Cancer 54:755-760, 1986[Medline]

4. Bernal AG, Cruz JJ, Sanchez P, et al: Four-day continuous infusion of cisplatin and 5-fluorouracil in head and neck cancer. Cancer 63:1927-1930, 1989[Medline]

5. The Department of Veterans Affairs Laryngeal Cancer Study Group: Induction chemotherapy plus radiation compared with surgery plus radiation in patients with advanced laryngeal cancer: The Department of Veterans Affairs Laryngeal Cancer Study Group. N Engl J Med 324:1685-1690, 1991[Abstract]

6. Spaulding MB, Castillo M, Lore J, et al: Surgery vs chemotherapy plus surgery for carcinoma of the head and neck. Otolaryngol Head Neck Surg 118:248-251, 1992

7. Spaulding MB, Fischer SG, Wolf GT: Tumor response, toxicity, and survival after neoadjuvant organ-preserving chemotherapy for advanced laryngeal carcinoma: The Department of Veterans Affairs Cooperative Laryngeal Cancer Study Group. J Clin Oncol 12:1592-1599, 1994[Abstract/Free Full Text]

8. Wolf GT, Makuch RW, Baker SR: Predictive factors for tumor response to preoperative chemotherapy in patients with head and neck squamous carcinoma: The Head and Neck Contracts Program. Cancer 54:2869-2877, 1984[Medline]

9. Bachaud JM, David JM, Shubinski RE, et al: Predictive factors of a complete response to and adverse effects of a CDDP-5FU combination as primary therapy for head and neck squamous carcinomas. J Laryngol Otol 107:924-930, 1993[Medline]

10. Cho Y, Gorina S, Jeffrey PD, et al: Crystal structure of p53 tumor suppressor-DNA complex: Understanding tumorigenic mutation. Science 265:334-335, 1994[Free Full Text]

11. Lane DP: Cancer: p53, guardian of the genome. Nature 358:15-16, 1992[Medline]

12. Eastman A: Activation of programmed cell death by anticancer agents: Cisplatin as a model system. Cancer Cells 2:275-280, 1990[Medline]

13. Lowe SW, Ruley HE, Jacks T, et al: p53-dependent apoptosis modulates the cytotoxicity of anticancer agents. Cell 74:957-967, 1993[Medline]

14. Lowe SW, Bodis S, McClatchey A, et al: p53 status and the efficacy of cancer therapy in vivo. Science 266:807-810, 1994[Abstract/Free Full Text]

15. Fan S, el-Deiry WS, Bae I, et al: p53 gene mutations are associated with decreased sensitivity of human lymphoma cells to DNA damaging agents. Cancer Res 54:5824-5830, 1994[Abstract/Free Full Text]

16. Fujiwara T, Grimm EA, Mukhopadhyay T, et al: Induction of chemosensitivity in human lung cancer cells in vivo by adenovirus-mediated transfer of the wild-type p53 gene. Cancer Res 54:2287-2291, 1994[Abstract/Free Full Text]

17. Aas T, Borresen AL, Geisler S, et al: Specific P53 mutations are associated with de novo resistance to doxorubicin in breast cancer patients. Nat Med 2:811-814, 1996[Medline]

18. Bergh J, Norberg T, Sjogren S, et al: Complete sequencing of the p53 gene provides prognostic information in breast cancer patients, particularly in relation to adjuvant systemic therapy and radiotherapy. Nat Med 1:1029-1034, 1995[Medline]

19. Perego P, Giarola M, Righetti SC, et al: Association between cisplatin resistance and mutation of p53 gene and reduced bax expression in ovarian carcinoma cell systems. Cancer Res 56:556-562, 1996[Abstract/Free Full Text]

20. Ribeiro U Jr, Finkelstein SD, Safatle-Ribeiro AV, et al: p53 sequence analysis predicts treatment response and outcome of patients with esophageal carcinoma. Cancer 83:7-18, 1998[Medline]

21. Benhattar J, Cerottini JP, Saraga E, et al: p53 mutations as a possible predictor of response to chemotherapy in metastatic colorectal carcinomas. Int J Cancer 69:190-192, 1996[Medline]

22. Scholnick SB, Sun PC, Shaw ME, et al: Frequent loss of heterozygosity for Rb, TP53, and chromosome arm 3p, but not NME1 in squamous cell carcinomas of the supraglottic larynx. Cancer 73:2472-2480, 1994[Medline]

23. Beahrs O , Henson DE, Huters RVP (eds): Manual for Staging of Cancer (ed 3). Philadelphia, PA,Lippincott, 1988, pp 39-44

24. Oken MM, Creech RH, Tormey DC, et al: Toxicity and response criteria of the Eastern Cooperative Oncology Group. Oncol 5:649-655, 1982

25. Hamelin R, Jego N, Laurent-Puig P, et al: Efficient screening of p53 mutations by denaturing gradient gel electrophoresis in colorectal tumors. Oncogene 8:2213-2220, 1993[Medline]

26. Guldberg P, Nedergaard T, Nielsen HJ, et al: Single-step DGGE-based mutation scanning of the p53 gene: Application to genetic diagnosis of colorectal cancer. Mutat 9:348-355, 1997

27. Lubin R, Schlichtholz B, Teillaud JL, et al: p53 antibodies in patients with various types of cancer: Assay, identification, and characterization. Cancer Res 1:1463-1469, 1995

28. Brachman DG, Graves D, Vokes E, et al: Occurrence of p53 gene deletions and human papilloma virus infection in human head and neck cancer. Cancer Res 52:4832-4836, 1992[Abstract/Free Full Text]

29. Boyle JO, Hakim J, Koch W, et al: The incidence of p53 mutations increases with progression of head and neck cancer. Cancer Res 53:4477-4480, 1993[Abstract/Free Full Text]

30. Somers KD, Merrick MA, Lopez ME, et al: Frequent p53 mutations in head and neck cancer. Cancer Res 52:5997-6000, 1992[Abstract/Free Full Text]

31. Kropveld A, Slootweg PJ, van Mansfeld AD, et al: Radioresistance and p53 status of T2 laryngeal carcinoma: Analysis by immunohistochemistry and denaturing gradient gel electrophoresis. Cancer 78:991-997, 1996[Medline]

32. Ahomadegbe JC, Barrois M, Fogel S, et al: High incidence of p53 alterations (mutation, deletion, overexpression) in head and neck primary tumors and metastases: Absence of correlation with clinical outcome—Frequent protein overexpression in normal epithelium and in early non-invasive lesions. Oncogene 10:1217-1227, 1995[Medline]

33. Greenblatt MS, Bennett WP, Hollstein M, et al: Mutations in the p53 tumor suppressor gene: Clues to cancer etiology and molecular pathogenesis. Cancer Res 54:4855-4878, 1994[Free Full Text]

34. el-Naggar AK, Lai S, Luna MA, et al: Sequential p53 mutation analysis of pre-invasive and invasive head and neck squamous carcinoma. Int J Cancer 64:196-201, 1995[Medline]

35. Lenz HJ, Hayashi K, Salonga D, et al: p53 point mutations and thymidylate synthase messenger RNA levels in disseminated colorectal cancer: An analysis of response and survival. Clin Cancer Res 4:1243-1250, 1998[Abstract]

36. Gallagher WM, Cairney M, Schott B, et al: Identification of p53 genetic suppressor elements which confer resistance to cisplatin. Oncogene 14:185-193, 1997[Medline]

37. Houldsworth J, Xiao H, Murty VV, et al: Human male germ cell tumor resistance to cisplatin is linked to TP53 gene mutation. Oncogene 16:2345-2349, 1998[Medline]

38. Hsiao M, Low J, Dorn E, et al: Gain-of-function mutations of the p53 gene induce lymphohematopoietic metastatic potential and tissue invasiveness. Am J Pathol 145:702-714, 1994[Abstract]

39. Dittmer D, Pati S, Zambetti G, et al: Gain of function mutations in p53. Nat Genet 4:42-46, 1993 [Medline]

40. Erber R, Conradt C, Homann N, et al: TP53 DNA contact mutations are selectively associated with allelic loss and have a strong clinical impact in head and neck cancer. Oncogene 16:1671-1679, 1998[Medline]

41. Hamilton TC, Winker MA, Louie KG, et al: Augmentation of adriamycin, melphalan, and cisplatin cytotoxicity in drug-resistant and -sensitive human ovarian carcinoma cell lines by buthionine sulfoximine mediated glutathione depletion. Biochem Pharmacol 34:2583-2586, 1985[Medline]

42. Ishikawa T, Ali-Osman F: Glutathione-associated cis-diamminedichloroplatinum(II) metabolism and ATP-dependent efflux from leukemia cells: Molecular characterization of glutathione-platinum complex and its biological significance. J Biol Chem 268:20116-20125, 1993[Abstract/Free Full Text]

43. Kelley SL, Basu A, Teicher BA, et al: Overexpression of metallothionein confers resistance to anticancer drugs. Science 241:1813-1815, 1988[Abstract/Free Full Text]

44. Kirihara Y, Yamamoto W, Toge T, et al: Dihydropyrimidine dehydrogenase, multidrug resistance-associated protein, and thymidylate synthase gene expression levels can predict 5- fluorouracil resistance in human gastrointestinal cancer cells. Int J Oncol 14:551-556, 1999[Medline]

45. Ishikawa Y, Kubota T, Otani Y, et al: Dihydropyrimidine dehydrogenase activity and messenger RNA level may be related to the antitumor effect of 5-fluorouracil on human tumor xenografts in nude mice. Clin Cancer Res 5:883-889, 1999[Abstract/Free Full Text]

46. Davidoff AM, Iglehart JD, Marks JR: Immune response to p53 is dependent upon p53/HSP70 complexes in breast cancers. Proc Natl Acad Sci U S A 89:3439-3442, 1992[Abstract/Free Full Text]

47. Winter SF, Minna JD, Johnson BE, et al: Development of antibodies against p53 in lung cancer patients appears to be dependent on the type of p53 mutation. Res 52:4168-4174, 1992

48. von Brevern MC, Hollstein MC, Cawley HM, et al: Circulating anti-p53 antibodies in esophageal cancer patients are found predominantly in individuals with p53 core domain mutations in their tumors. Cancer Res 56:4917-4921, 1996[Abstract/Free Full Text]

Submitted April 30, 1999; accepted November 29, 1999.




This article has been cited by other articles:


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
E. M. Smith, D. Wang, L. M. Rubenstein, W. A. Morris, L. P. Turek, and T. H. Haugen
Association between p53 and Human Papillomavirus in Head and Neck Cancer Survival
Cancer Epidemiol. Biomarkers Prev., February 1, 2008; 17(2): 421 - 427.
[Abstract] [Full Text] [PDF]


Home page
J. Dent. Res.Home page
S. Choi and J.N. Myers
Molecular Pathogenesis of Oral Squamous Cell Carcinoma: Implications for Therapy
J. Dent. Res., January 1, 2008; 87(1): 14 - 32.
[Abstract] [Full Text] [PDF]


Home page
Hum Exp ToxicolHome page
J Peltonen, J A Welsh, and K H Vahakangas
Is there a role for PCR-SSCP among the methods for missense mutation detection of TP53 gene?
Human and Experimental Toxicology, January 1, 2007; 26(1): 9 - 18.
[Abstract] [PDF]


Home page
JCOHome page
L. Licitra, F. Perrone, P. Bossi, S. Suardi, L. Mariani, R. Artusi, M. Oggionni, C. Rossini, G. Cantu, M. Squadrelli, et al.
High-Risk Human Papillomavirus Affects Prognosis in Patients With Surgically Treated Oropharyngeal Squamous Cell Carcinoma
J. Clin. Oncol., December 20, 2006; 24(36): 5630 - 5636.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
F. Perrone, S. Suardi, E. Pastore, P. Casieri, M. Orsenigo, S. Caramuta, G. Dagrada, M. Losa, L. Licitra, P. Bossi, et al.
Molecular and Cytogenetic Subgroups of Oropharyngeal Squamous Cell Carcinoma.
Clin. Cancer Res., November 15, 2006; 12(22): 6643 - 6651.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
D. G. Pfister, S. A. Laurie, G. S. Weinstein, W. M. Mendenhall, D. J. Adelstein, K. K. Ang, G. L. Clayman, S. G. Fisher, A. A. Forastiere, L. B. Harrison, et al.
American Society of Clinical Oncology Clinical Practice Guideline for the Use of Larynx-Preservation Strategies in the Treatment of Laryngeal Cancer
J. Clin. Oncol., August 1, 2006; 24(22): 3693 - 3704.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
P Alhopuro, S K Ylisaukko-oja, W J Koskinen, P Bono, J Arola, H J Jarvinen, J-P Mecklin, T Atula, R Kontio, A A Makitie, et al.
The MDM2 promoter polymorphism SNP309T->G and the risk of uterine leiomyosarcoma, colorectal cancer, and squamous cell carcinoma of the head and neck
J. Med. Genet., September 1, 2005; 42(9): 694 - 698.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
P. A. Kyzas, K. T. Loizou, and J. P. A. Ioannidis
Selective Reporting Biases in Cancer Prognostic Factor Studies
J Natl Cancer Inst, July 20, 2005; 97(14): 1043 - 1055.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
F. Vikhanskaya, M. M. Siddique, M. Kei Lee, M. Broggini, and K. Sabapathy
Evaluation of the Combined Effect of p53 Codon 72 Polymorphism and Hotspot Mutations in Response to Anticancer Drugs
Clin. Cancer Res., June 15, 2005; 11(12): 4348 - 4356.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
L. Licitra, S. Suardi, P. Bossi, L.D. Locati, L. Mariani, P. Quattrone, S. Lo Vullo, M. Oggionni, P. Olmi, G. Cantu, et al.
Prediction of TP53 Status for Primary Cisplatin, Fluorouracil, and Leucovorin Chemotherapy in Ethmoid Sinus Intestinal-Type Adenocarcinoma
J. Clin. Oncol., December 15, 2004; 22(24): 4901 - 4906.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
J. C. Rhee, F. R. Khuri, and D. M. Shin
Advances in Chemoprevention of Head and Neck Cancer
Oncologist, June 1, 2004; 9(3): 302 - 311.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Blons, S. Gad, F. Zinzindohoue, I. Maniere, J. Beauregard, D. Tregouet, D. Brasnu, P. Beaune, O. Laccourreye, and P. Laurent-Puig
Matrix Metalloproteinase 3 Polymorphism: A Predictive Factor of Response to Neoadjuvant Chemotherapy in Head and Neck Squamous Cell Carcinoma
Clin. Cancer Res., April 15, 2004; 10(8): 2594 - 2599.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
L. Licitra and J. B. Vermorken
Is there still a role for neoadjuvant chemotherapy in head and neck cancer?
Ann. Onc., January 1, 2004; 15(1): 7 - 11.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Geisler, A.-L. Borresen-Dale, H. Johnsen, T. Aas, J. Geisler, L. A. Akslen, G. Anker, and P. E. Lonning
TP53 Gene Mutations Predict the Response to Neoadjuvant Treatment with 5-Fluorouracil and Mitomycin in Locally Advanced Breast Cancer
Clin. Cancer Res., November 15, 2003; 9(15): 5582 - 5588.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Ott, H. Vogelsang, J. Mueller, K. Becker, M. Muller, U. Fink, J. R. Siewert, H. Hofler, and G. Keller
Chromosomal Instability Rather Than p53 Mutation Is Associated with Response to Neoadjuvant Cisplatin-based Chemotherapy in Gastric Carcinoma
Clin. Cancer Res., June 1, 2003; 9(6): 2307 - 2315.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
C. Monnerat, S. Faivre, S. Temam, J. Bourhis, and E. Raymond
End points for new agents in induction chemotherapy for locally advanced head and neck cancers
Ann. Onc., July 1, 2002; 13(7): 995 - 1006.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Tonisson, J. Zernant, A. Kurg, H. Pavel, G. Slavin, H. Roomere, A. Meiel, P. Hainaut, and A. Metspalu
Evaluating the arrayed primer extension resequencing assay of TP53 tumor suppressor gene
PNAS, April 16, 2002; 99(8): 5503 - 5508.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
J.-C. Lin, K. Y. Chen, W.-Y. Wang, J.-S. Jan, W.-M. Liang, C.-S. Tsai, and Y.-H. Wei
Detection of Epstein-Barr Virus DNA in the Peripheral-Blood Cells of Patients With Nasopharyngeal Carcinoma: Relationship to Distant Metastasis and Survival
J. Clin. Oncol., May 15, 2001; 19(10): 2607 - 2615.
[Abstract] [Full Text] [PDF]


This Article