|
Advertisement |
|
|
||
 |
|
|||||
|
|||||
|
 |
||||||
|
||||||
|
||||||
|
© 2000 American Society for Clinical Oncology Gene Expression for Dihydropyrimidine Dehydrogenase and Thymidine Phosphorylase Influences Outcome in Epithelial Ovarian CancerFrom the Department of Obstetrics and Gynecology, Shimane Medical University, Izumo, and Department of Pathology, Institute of Development, Aging and Cancer, Tohoku University, Sendai, Japan. Address reprint requests to Kohkichi Hata, MD, Department of Obstetrics and Gynecology, Shimane Medical University, Izumo 693-8501, Japan; email hata31{at}shimane-med.ac.jp
PURPOSE: Dihydropyrimidine dehydrogenase (DPD) is a pyrimidine salvage enzyme responsible for degradation of thymine, which is produced from thymidine by thymidine phosphorylase (TP). Our purpose was to determine whether DPD affects prognosis in patients with epithelial ovarian cancer and how the two enzymes may interact in such effects. PATIENTS AND METHODS: DPD gene expression was analyzed by reverse transcription-polymerase chain reaction in 27 samples from normal ovaries and the 85 epithelial ovarian cancers previously studied with regard to TP gene expression. RESULTS: DPD gene expression was significantly lower in epithelial ovarian cancers than in normal ovaries (P < .0001), whereas TP gene expression and the ratio of TP to DPD gene expression (TP:DPD) were significantly higher in epithelial ovarian cancer (P < .0001 for both). In patients with epithelial ovarian cancer, DPD gene expression and the TP:DPD ratio did not significantly correlate with any clinicopathologic factors. Patients with a high TP:DPD ratio (higher than the median) had significantly poorer outcomes than those with lower ratios (P = .0002). The difference in survival between groups with high and low TP:DPD ratios was greater than the difference between groups with high and low TP gene expression. Multivariate analysis showed the TP:DPD ratio to be the independent prognostic factor (P = .0002). In tumors with high TP gene expression, low DPD gene expression significantly correlated with poor survival (P = .04). CONCLUSION: Downregulation of DPD gene expression may enhance the negative prognostic effect of high TP gene expression in patients with epithelial ovarian cancer. Certain newly available chemotherapeutic choices may take the TP:DPD ratio into consideration.
DIHYDROPYRIMIDINE dehydrogenase (DPD; EC 1.3.1.2) and thymidine phosphorylase (TP; EC 2.4.2.4) are important enzymes in the pyrimidine salvage pathway.1-4 TP catalyzes the reversible phosphorolysis of thymidine from the extracellular fluid to thymine and 2-deoxy-D-ribose-1 phosphate.1,2 Subsequently, thymine is degraded to CO2 and beta-aminoisobutyric acid in three sequential reactions.3,4 DPD, the first and rate-limiting enzyme of this chain, is responsible for the conversion of thymine to dihydrothymine.3,4 Early experimental analyses of human tumor cell xenografts showed a wide range of DPD enzymatic activity among various solid and hematopoietic cancers.5-7 An inverse relation between DPD activity and malignant behavior in murine neuroblastoma cell lines has been suggested.8 As for clinical studies, since DPD is responsible for degradation of fluorouracil (5-FU) as well as thymine,9 intratumoral DPD activity has been investigated in patients with head and neck,10 hepatocellular,11 and colorectal12 cancers treated with 5-FU. DPD activity and the ratio of DPD in tumors to that in uninvolved parts of an organ were variable among individual tumors,10-12 and increased DPD activity correlated with poor clinical response to 5-FU–based chemotherapy.10-12 Since sufficient human tumor tissue for DPD enzyme assays is not ordinarily available, reverse transcription (RT) polymerase chain reactions (PCRs) can be used to determine the relative DPD mRNA level in small specimens.13,14 Although gene expression is not a direct measure of enzymatic activity, a significant correlation between DPD gene expression and DPD activity has been demonstrated.14 Similar to DPD activity, high levels of DPD gene expression have been associated with poor clinical response to 5-FU in nude mice with gastric cancer xenografts14 as well as in colorectal cancer patients.13 TP, which is identical to platelet-derived endothelial cell growth factor,15 and the degradation products thymine and 2-deoxy-D-ribose have angiogenic and antiapoptotic effects that are associated with tumor aggressiveness and poor survival.2,16-21 TP itself is chemotactic to endothelial cells in vitro and is angiogenic in vivo,16,17 and 2-deoxy-D-ribose also is angiogenic.18 Human KB epidermoid carcinoma cells transfected with TP cDNA became resistant to hypoxia-induced apoptosis.19 Thymine and 2-deoxy-D-ribose also prevented hypoxia-induced apoptosis.19 Recently, we reported that the concentration of TP protein in ovarian tumor tissue was positively correlated with the disordered angiogenesis measured by pulsed Doppler ultrasound.22 Moreover, TP gene expression correlated with poor survival in patients with epithelial ovarian cancer, although only by univariate analysis.23 However, prognostic relationships between TP and DPD and whether DPD alone can affect patient prognosis in these tumors remain unclear. In this study, we examined DPD gene expression using RT-PCR in specimens from normal ovaries and epithelial ovarian cancers treated with cisplatin-based chemotherapy, and we investigated interrelationships between DPD and TP gene expression with respect to survival.
Patients Patients for this study were selected from among patients with epithelial ovarian cancer treated between January 1990 and December 1998 at the Shimane Medical University Hospital, Izumo, Japan, and affiliated hospitals. Eligible patients had a histologic diagnosis of epithelial ovarian cancer, were younger than 80 years old, and were suitable for adequate surgical staging. Patients were excluded from this study if fresh, surgically resected specimens could not be obtained or, preoperatively, if they had undergone any therapy, had multiple cancers, or had severe complications. All research was conducted with patients’ informed consent and with the approval of the hospital research ethics board. Clinical data were collected from the patients’ hospital records. The median age of the 85 eligible patients was 54 years (range, 19 to 76 years). The patients were staged according to the 1987 criteria recommended by the International Federation of Gynecology and Obstetrics (FIGO).24 There were 27 stage I patients, seven stage II patients, 43 stage III patients, and eight stage IV patients. The staging system defined by FIGO, as described elsewhere,23 assumes that an adequate staging operation has been performed. Tumors were classified histologically according to World Health Organization (WHO) criteria25 as serous (n = 40), mucinous (n = 22), endometrioid (n = 14), clear cell (n = 6), and undifferentiated (n = 3). The tumors were classified histologically either as having low malignant potential (LMP; n = 10) or as being well differentiated (n = 17), moderately differentiated (n = 32), or poorly differentiated (n = 26).26 Of the 85 eligible patients, 83 received cisplatin-based regimens. Two patients with stage I tumors of LMP received no further treatment after surgery. No patients received fluoropyrimidine-containing regimens. The median duration of follow-up was 20 months (range, 2 to 120 months). Twenty-seven normal ovarian specimens obtained from women who had undergone oophorectomy for nonovarian conditions (14 for myoma uteri, nine for cervical intraepithelial neoplasia, three for early cervical cancer, and two for early endometrial cancer) were examined as controls. Normal controls included two specimens in the menstrual phase, three in the proliferative phase, and eight in the secretory phase. Fourteen other control specimens were from postmenopausal women. The median age of these patients was 52 years (range, 41 to 74 years).
RT-PCR
RT-PCR assays for determination of DPD gene expression were performed according to a method previously described.26 Briefly, cDNA was prepared by random priming from 500 ng of total RNA using a first-strand cDNA synthesis kit (Pharmacia-LKB, Uppsala, Sweden). Pairs of oligonucleotide primers for PCR were designed to insert an intron in the corresponding genomic sequence to eliminate amplification from genomic DNA. The primers for the human DPD gene (GenBank accession no. U09178) amplification were CTCCATTGCCATCGATACG (upstream) and CCTTAGCAAGCTCCATCTCC (downstream), and the expected PCR product was 158 base pairs. The PCR assay was carried out in a thermal cycler (Perkin-Elmer Cetus, Norwalk, CT) with a mixture consisting of cDNA derived from 5 ng of RNA, 10 pmol of the upstream and downstream primers for the DPD gene, 5 pmol of primers for the beta-2-microglobulin (ß2-MG) gene (GenBank accession no. U00567; upstream primer: ACCCCCACTGAAAAAGATGAG; downstream primer: ATCTTCAAACCTCCATGATGC producing a 120-base pair fragment), 200 µmol of each deoxynucleotide triphosphate, 37 kBq of [ To determine the number of PCR cycles appropriate for quantification, PCR assays were performed from 20 to 50 cycles at an increase of five cycles. The expression ratios of DPD to ß2-MG gene were reasonably constant from 25 to 35 cycles (data not shown). Therefore, in the subsequent experiments, the values at 30 PCR cycles were defined as the expression of target genes. The value of DPD gene expression was determined to be the mean values from at least three independent RT-PCR experiments. Results of the RT-PCR assay for the TP gene have previously been reported, and the levels of TP gene expression for 56 out of 85 patients with epithelial ovarian cancer have been described.22
Statistical Analysis
The median ratio of DPD gene expression to ß2-MG gene expression was 0.45 (range, 0.10 to 1.19) in normal ovaries and 0.21 (range, 0.03 to 1.40) in epithelial ovarian cancers. DPD gene expression was significantly lower in epithelial ovarian cancer specimens than in normal ovary specimens (P < .0001). Median TP gene expression was 0.34 (range, 0.09 to 0.96) and 0.92 (range, 0.19 to 5.38) in normal ovaries and epithelial ovarian cancers, respectively. TP gene expression was significantly higher in epithelial ovarian cancer specimens than in normal ovary specimens (P < .0001). Simple regression analysis showed no correlation between DPD and TP gene expression in overall specimens (r2 = .001, n = 112; Fig 1) or in epithelial ovarian cancers (r2 = .06, n = 85).
In patients with epithelial ovarian cancer, DPD gene expression did not correlate with age (P = .44), FIGO stage (P = .79), histologic type (P = .11), histologic grade (P = .95), or status of residual disease (P = .88). Low DPD gene expression (  the median) tended to correlate with worse survival in all 85 patients, but the difference was not significant (P = .07; Fig 2).
For combined analysis of DPD and TP gene status, we calculated the TP:DPD ratio. The median TP:DPD ratio was 0.61 (range, 0.25 to 4.97) in normal ovaries and 4.85 (range, 0.54 to 74.10) in epithelial ovarian cancers. The TP:DPD ratio was significantly higher in epithelial ovarian cancer specimens than in normal ovary specimens (P < .0001). In patients with epithelial ovarian cancer, there was no significant correlation between the TP:DPD ratio and any clinicopathologic factors (age, P = .83; FIGO stage, P = .07; histologic type, P = .17; histologic grade, P = .06; status of residual disease, P = .11). Patients whose tumors showed a high TP:DPD ratio (higher than the median) had a significantly poorer prognosis (P = .0002; Fig 3), and the difference in survival between groups with high and low TP:DPD ratios was greater than the difference between groups with high and low TP gene expression (P = .02). Moreover, whereas FIGO stage III to IV (P = .0002), poor histologic differentiation (P = .03), and positive residual disease (P = .007) correlated significantly with poor survival by univariate analysis (Table 1), multivariate analysis showed TP:DPD ratio and clinical stage to be the independent prognostic factors (P = .0002 and P = .009, respectively). Additionally, low DPD gene expression ( the median) correlated significantly with poor survival among patients whose tumors showed high TP gene expression (higher than the median) by univariate analysis (Fig 4; P = .04).
In this study, we examined DPD gene expression and related it to previously determined TP gene expression in tissue samples from normal ovaries and epithelial ovarian cancers. We found DPD gene expression to be highly variable among the tumors examined, with the highest expression being 47 times greater than the lowest. DPD gene expression was significantly lower in epithelial ovarian cancer than in normal ovary. In specimens from patients with head and neck cancer, Etienne et al10 reported that the median ratio of tumor DPD activity to DPD activity in uninvolved tissues was 1.04. However, two other studies have found DPD activity in hepatocellular11 and colorectal carcinomas12 to be significantly lower than that in adjacent normal tissues, in agreement with our results in epithelial ovarian cancer. Although DPD activity has been demonstrated to be inhibited by certain substrates, such as uridine, thymidine, uracil, thymine, and reduced nicotinamide adenine dinucleotide phosphate, in various tissues studied in vitro,5-7,9,27 the mechanisms of DPD downregulation in malignant tissues remain unclear. In contrast to DPD gene expression, TP gene expression was significantly higher in epithelial ovarian cancer specimens than in normal ovary specimens. Our results are consistent with previous studies that found elevated levels of TP protein2,20,28 and its mRNA21,29 in a variety of human malignant tumor cells. Typical microenvironmental characteristics in cancer tissues, such as hypoxia and low pH, result in specific upregulation of TP expression.30 Although the relationship between intratumoral DPD activity and clinical response has been investigated in several cancers treated with 5-FU–based chemotherapy,10-12 the influence of DPD on prognosis in cancer patients treated with other chemotherapeutic regimens has not been clarified. We found that low DPD gene expression tended to correlate with poor survival in patients with epithelial ovarian cancer treated with cisplatin-based chemotherapy and correlated significantly with poor survival in the subgroup of patients whose tumors showed high TP gene expression. Interestingly, these results are contrary to some studies in which high DPD activity was found to correlate with poor clinical response to 5-FU.10-12 Our preliminary report demonstrated elevated TP gene expression to be significantly correlated with poor survival by univariate analysis in 56 patients,23 but the prognostic significance of TP was no longer evident when multivariate analysis was performed. Therefore, we investigated the relative preponderance of DPD and TP gene expression with respect to survival. Considering the favorable prognostic effect of DPD gene expression and the negative effect of TP gene expression, we calculated a TP:DPD ratio for combined analysis of DPD and TP gene status. The relative risk of cancer death from tumors with a high TP:DPD ratio was greater than the risk from tumors with only high TP gene expression. By multivariate analysis, the TP:DPD ratio was the strongest independent predictor of survival, while the FIGO stage also was an independent prognostic factor. Tuchman et al8 reported that DPD activity in a highly malignant murine neuroblastoma cell line (MNB-T1) was lower than that in a less malignant cell line (MNB-T2); nude mice engrafted with MNB-T1 cells had a higher mortality rate than mice receiving MNB-T2–cell grafts. The authors suggest that the level of DPD activity in neoplastic cells is inversely related to malignant behavior. Additionally, DPD downregulation could be a consequence of molecular events not considered here that are nonetheless important for prognosis. Although details of underlying mechanisms remain unclear, our findings suggest that downregulation of DPD gene expression directly or indirectly enhances the negative prognostic effect of TP gene expression in patients with epithelial ovarian cancer. Although this study involved only a small number of patients, we found the TP:DPD ratio to be the independent prognostic factor in patients with epithelial ovarian cancer. The combined analysis of DPD and TP gene expression may be useful for predicting the survival of patients with epithelial ovarian cancer. The new cytostatic agent capecitabine (N4-pentyloxycarbonyl-5'-deoxy-5-fluorocytidine) is a fluoropyrimidine carbamate that is converted selectively in tumors to active 5-FU via the intermediate metabolite 5'-deoxy-5-fluorouridine. This intermediate is metabolized to 5-FU by TP, and subsequently 5-FU is catabolized to dihydrofluorouracil by DPD.31 In a phase I clinical trial, capecitabine was found to be a tolerable oral therapy with promising clinical activity in a variety of malignant tumors, including ovarian cancers.32 Recently, the efficacy of capecitabine was shown to correlate with a high TP:DPD activity ratio in xenograft models of various human cancer cell lines.31 Capecitabine might have a high efficacy as a result of selectively producing high levels of 5-FU in tumors with a high TP:DPD ratio. These data suggest that patients whose epithelial ovarian cancers show a high TP:DPD ratio might particularly benefit from treatment with capecitabine.
We thank Professor Suminori Akiba, Department of Public Health, Faculty of Medicine, Kagoshima University, Japan, for the statistical analysis.
1. Iltzsch MH, el Kouni MH, Cha S: Kinetic studies of thymidine phosphorylase from mouse liver. Biochemistry 24: 6799-6807, 1985[Medline] 2. Brown NS, Bicknell R: Thymidine phosphorylase, 2-deoxy-D-ribose and angiogenesis. Biochem J 334: 1-8, 1998
3.
Canellakis ES: Pyrimidine metabolism-enzymatic pathways of uracil and thymidine degradation. J Biol Chem 221: 315-322, 1956 4. Fink RM, Fink K, Henderson RB: Beta-amino acid formation by tissue slices incubated with pyrimidines. J Biol Chem 201: 349-355, 1955 5. Naguib FN, el Kouni MH, Cha S: Enzymes of uracil catabolism in normal and neoplastic human tissues. Cancer Res 45: 5405-5412, 1985[Medline] 6. Ho DH, Townsend L, Luna MA, et al: Distribution and inhibition of dihydrouracil dehydrogenase activities in human tissues using 5-fluorouracil as a substrate. Anticancer Res 6: 781-784, 1986[Medline]
7.
Queener SF, Morris HP, Weber G: Dihydrouracil dehydrogenase activity in normal, differentiating and regenerating liver and hepatomas. Cancer Res 31: 1004-1009, 1971 8. Tuchman M, O’Dea RF, Ramnaraine ML, et al: Pyrimidine base degradation in cultured murine C-1300 neuroblastoma cells and in situ tumors. J Clin Invest 81: 425-430, 1988 9. Tuchman M, Ramnaraine ML, O’Dea RF: Effects of uridine and thymidine on the degradation of 5-fluorouracil, uracil, and thymine by rat liver dihydropyrimidine dehydrogenase. Cancer Res 45: 5553-5556, 1985[Medline]
10.
Etienne MC, Cheradame S, Fischel JL, et al: Response to fluorouracil therapy in cancer patients: The role of tumoral dihydropyrimidine dehydrogenase activity. J Clin Oncol 13: 1663-1670, 1995 11. Jiang W, Lu Z, He Y, et al: Dihydropyrimidine dehydrogenase activity in hepatocellular carcinoma: Implication in 5-fluorouracil-based chemotherapy. Clin Cancer Res 3: 395-359, 1997[Abstract] 12. McLeod HL, Sludden J, Murray GI, et al: Characterization of dihydropyrimidine dehydrogenase in human colorectal tumours. Br J Cancer 77: 461-465, 1998[Medline] 13. Diasio RB, Danenberg K, Johnson M, et al: Quantitation of dihydropyrimidine dehydrogenase in tumor specimens of patients treated with 5-fluorouracil using quantitative polymerase chain reaction assay. Proc Am Assoc Cancer Res 39: 188, 1998 (abstr)
14.
Ishikawa Y, Kubota T, Otani Y, et al: Dihydropyrimidine dehydrogenase activity and messenger RNA level may be related to the antitumor effect of 5-fluorouracil on human tumor xenografts in nude mice. Clin Cancer Res 5: 883-889, 1999 15. Furukawa T, Yoshimura A, Sumizawa T, et al: Angiogenic factor. Nature 356: 668, 1992 (letter)[Medline] 16. Ishikawa F, Miyadera K, Hellman U, et al: Identification of angiogenic activity and the cloning and expression of platelet-derived endothelial cell growth factor. Nature 338: 557-562, 1989[Medline]
17.
Moghaddam A, Zhang HT, Fan TP, et al: Thymidine phosphorylase is angiogenic and promotes tumor growth. Proc Natl Acad U S A 92: 998-1002, 1995 18. Haraguchi M, Kazutaka M, Uemura K, et al: Angiogenic activity of enzymes. Nature 368: 198, 1994 (letter)[Medline] 19. Kitazono M, Takebayashi Y, Ishitsuka K, et al: Prevention of hypoxia-induced apoptosis by the angiogenic factor thymidine phosphorylase. Biochem Biophys Res Commun 253: 797-803, 1998[Medline]
20.
Takebayashi Y, Akiyama S, Akiba S, et al: Clinicopathologic and prognostic significance of an angiogenic factor, thymidine phosphorylase, in human colorectal carcinoma. J Natl Cancer Inst 88: 1110-1117, 1996 21. Fujimoto J, Sakaguchi H, Hirose R, et al: Expression of platelet-derived endothelial cell growth factor (PD-ECGF) and its mRNA in uterine cervical cancers. Br J Cancer 79: 1249-1254, 1999[Medline] 22. Hata K, Hata T, Collins WP: Association of thymidine phosphorylase concentration with ultrasound-derived indices of blood flow in ovarian masses. Cancer 80: 1079-1084, 1997[Medline] 23. Hata K, Kamikawa T, Arao S, et al: Expression of the thymidine phosphorylase gene in epithelial ovarian cancer. Br J Cancer 79: 1848-1854, 1999[Medline] 24. International Federation of Gynecology and Obstetrics: Changes in definitions of clinical staging for carcinoma of the cervix and ovary. Am J Obstet Gynecol 156: 263-264, 1989 25. Serov SF, Scully RE, Sobin LH: International histological classification of tumours, no. 9: Histological typing of ovarian tumors. Geneva, Switzerland: World Health Organization, 1973
26.
Arao S, Suwa H, Mandai M, et al: Expression of multidrug resistance gene and localization of P-glycoprotein in human primary ovarian cancer. Cancer Res 54: 1355-1359, 1994
27.
Pero RW, Johnson D, Olsson A: Catabolism of exogenously supplied thymidine to thymine and dihydrothymine by platelets in human peripheral blood. Cancer Res 44: 4955-4961, 1984 28. Fujiwaki R, Hata K, Iida K, et al: Thymidine phosphorylase expression in progression of cervical cancer: Correlation with microvessel count, proliferating cell nuclear antigen, and apoptosis. J Clin Pathol 52: 598-603, 1999[Abstract]
29.
O’Brien TS, Fox SB, Dickison AJ, et al: Expression of the angiogenic factor thymidine phosphorylase/platelet-derived endothelial cell growth factor in primary bladder cancers. Cancer Res 56: 4799-4804, 1994
30.
Griffiths L, Dachs GU, Bicknell R, et al: The influence of oxygen tension and pH on the expression of platelet-derived endothelial cell growth factor/thymidine phosphorylase in human breast tumor cells grown in vitro and in vivo. Cancer Res 57: 570-572, 1997
31.
Ishikawa T, Sekiguchi F, Fukase Y, et al: Positive correlation between the efficacy of capecitabine and doxifluridine and the ratio of thymidine phosphorylase to dihydropyrimidine dehydrogenase activities in tumors in human cancer xenografts. Cancer Res 58: 685-690, 1998
32.
Mackean M, Planting A, Twelves C, et al: Phase I and pharmacologic study of intermittent twice-daily oral therapy with capecitabine in patients with advanced and/or metastatic cancer. J Clin Oncol 16: 2977-2985, 1998 Submitted September 15, 1999; accepted June 30, 2000. This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
|||||||||||
|
|||||||||||
|
|
Copyright © 2000 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
|
TOP
ABSTRACT
INTRODUCTION
-32P] deoxycytidine triphosphate, and 0.1 unit of Taq DNA polymerase with reaction buffer (Life Technologies, Rockville, MD) in a final volume of 10 µL. The PCR conditions were as follows: denaturation at 94°C for 1 minute, annealing at 58°C for 1 minute, and extension at 72°C for 1 minute for 30 cycles. The PCR products were separated on 9% polyacrylamide gels. The amount of radioactivity in the gel was determined using a BAS 2000 Bioimage Analyzer (Fujix, Tokyo, Japan). The DPD gene expression levels were calculated as the relative yield of the DPD gene to that of the ß2-MG gene. 
) and 85 epithelial ovarian cancers (•).
